eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	cystic fibrosis

Disease ID	38
Disease	cystic fibrosis
Definition	An autosomal recessive genetic disease of the EXOCRINE GLANDS. It is caused by mutations in the gene encoding the CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR expressed in several organs including the LUNG, the PANCREAS, the BILIARY SYSTEM, and the SWEAT GLANDS. Cystic fibrosis is characterized by epithelial secretory dysfunction associated with ductal obstruction resulting in AIRWAY OBSTRUCTION; chronic RESPIRATORY INFECTIONS; PANCREATIC INSUFFICIENCY; maldigestion; salt depletion; and HEAT PROSTRATION.
Synonym	cf - cystic fibrosis cystic disorder fibrosis cystic fibrosis (cf) cystic fibrosis (disorder) cystic fibrosis (disorder) [ambiguous] cystic fibrosis [disease/finding] cystic fibrosis nos cystic fibrosis nos (disorder) cystic fibrosis pancreas disease fibrocystic disease fibrocystic pancreas diseases fibrocystic fibrocystic disease fibrocystic disease of pancreas fibrosis, cystic mucoviscidosis pancreas cystic fibrosis
Orphanet	ORPHANET:586
OMIM	OMIM:219700
DOID	DOID:1485
UMLS	C0010674
MeSH	D003550
SNOMED-CT	SNOMEDCT_US_2016_09_01:190905008
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:175) C0024115 \| lung disease \| 64 C0004031 \| allergic bronchopulmonary aspergillosis \| 18 C0024115 \| pulmonary disease \| 17 C0004030 \| aspergillosis \| 17 C0030293 \| pancreatic insufficiency \| 15 C0023895 \| liver disease \| 14 C0011847 \| diabetes \| 14 C0006267 \| bronchiectasis \| 11 C0030305 \| pancreatitis \| 10 C1258215 \| ileus \| 9 C0032285 \| pneumonia \| 8 C0004623 \| bacterial infection \| 7 C0267963 \| exocrine pancreatic insufficiency \| 7 C0021400 \| influenza \| 7 C0024523 \| malabsorption \| 6 C0042769 \| virus infection \| 6 C0017168 \| esophageal reflux \| 6 C0017168 \| oesophageal reflux \| 6 C0020538 \| hypertension \| 6 C0042870 \| vitamin d deficiency \| 5 C0042870 \| vitamin d defic \| 5 C0005940 \| bone disease \| 5 C0029456 \| osteoporosis \| 5 C0149521 \| chronic pancreatitis \| 5 C0020542 \| pulmonary hypertension \| 4 C0004096 \| asthma \| 4 C0009806 \| constipation \| 4 C0004623 \| bacterial infections \| 4 C0162429 \| malnutrition \| 4 C0271650 \| glucose intolerance \| 4 C0034069 \| pulmonary fibrosis \| 4 C0017168 \| gastroesophageal reflux \| 4 C0011570 \| depression \| 4 C0009319 \| colitis \| 3 C0021843 \| intestinal obstruction \| 3 C0003467 \| anxiety \| 3 C0013990 \| emphysema \| 3 C1145670 \| respiratory failure \| 3 C0007570 \| celiac disease \| 3 C0042769 \| viral infections \| 3 C0032326 \| pneumothorax \| 3 C0002871 \| anemia \| 3 C0003864 \| arthritis \| 3 C0008370 \| cholestasis \| 3 C0600260 \| obstructive pulmonary disease \| 3 C0042769 \| viral infection \| 3 C0037199 \| sinusitis \| 2 C0033581 \| prostatitis \| 2 C1565489 \| renal insufficiency \| 2 C1800706 \| idiopathic pulmonary fibrosis \| 2 C0020456 \| hyperglycemia \| 2 C0017168 \| gastro-oesophageal reflux \| 2 C0006272 \| obliterative bronchiolitis \| 2 C0024530 \| malaria \| 2 C0041296 \| tuberculosis \| 2 C0022596 \| palmoplantar keratoderma \| 2 C0011849 \| diabetes mellitus \| 2 C0238106 \| clostridium difficile colitis \| 2 C0001623 \| adrenal insufficiency \| 2 C0022658 \| kidney disease \| 2 C1527358 \| phototoxicity \| 2 C0006271 \| bronchiolitis \| 2 C0022658 \| renal disease \| 2 C0008698 \| maxillary sinusitis \| 2 C0032285 \| pneumoniae \| 2 C0021400 \| influenzae \| 2 C0024117 \| chronic obstructive pulmonary disease \| 2 C0948187 \| tracheomalacia \| 1 C0016412 \| folic acid deficiency \| 1 C0024117 \| chronic obstructive lung disease \| 1 C0006840 \| candida infection \| 1 C0392525 \| nephrolithiasis \| 1 C0007124 \| intraductal carcinoma \| 1 C0020676 \| hypothyroidism \| 1 C0022679 \| cystic kidney \| 1 C0024299 \| lymphoma \| 1 C0398623 \| thrombophilia \| 1 C1257843 \| pseudomembranous colitis \| 1 C0035579 \| hypovitaminosis d \| 1 C0004623 \| bacterial disease \| 1 C0035328 \| retinal vein occlusion \| 1 C1335302 \| pancreatic ductal adenocarcinoma \| 1 C0740394 \| hyperuricemia \| 1 C0023890 \| cirrhosis \| 1 C0034069 \| lung fibrosis \| 1 C0016436 \| folliculitis \| 1 C0032285 \| pulmonary inflammation \| 1 C0740394 \| hyperuricaemia \| 1 C0085548 \| autosomal recessive polycystic kidney disease \| 1 C0032305 \| pneumocystis \| 1 C0006017 \| pertussis \| 1 C0039144 \| syringomyelia \| 1 C0021831 \| enteropathy \| 1 C0017168 \| gastroesophageal reflux disease \| 1 C0020541 \| portal hypertension \| 1 C0002726 \| amyloidosis \| 1 C0033845 \| idiopathic intracranial hypertension \| 1 C1140680 \| ovarian cancer \| 1 C0021843 \| bowel obstruction \| 1 C0027868 \| neuromuscular disease \| 1 C0019829 \| hodgkin's lymphoma \| 1 C0001418 \| adenocarcinoma \| 1 C0001430 \| adenoma \| 1 C0042345 \| varices \| 1 C0035078 \| renal failure \| 1 C0442874 \| neuropathy \| 1 C0024117 \| chronic obstructive pulmonary disease (copd) \| 1 C0019284 \| diaphragmatic hernia \| 1 C0085253 \| adult-onset still's disease \| 1 C0235974 \| pancreatic cancer \| 1 C0021364 \| male infertility \| 1 C0029443 \| osteomyelitis \| 1 C0013080 \| trisomy 21 \| 1 C0034888 \| rectal prolapse \| 1 C0030286 \| pancreatic disease \| 1 C0162429 \| malnourished \| 1 C0035934 \| rubinstein-taybi syndrome \| 1 C0004775 \| bartter's syndrome \| 1 C0011854 \| type 1 diabetes \| 1 C0598608 \| hyperhomocysteinemia \| 1 C0340238 \| bronchial infection \| 1 C0008350 \| gallstones \| 1 C0008049 \| varicella \| 1 C0021831 \| bowel disorders \| 1 C0037315 \| sleep-disordered breathing \| 1 C0031154 \| peritonitis \| 1 C0004775 \| bartter syndrome \| 1 C0013182 \| drug hypersensitivity \| 1 C0017168 \| esophageal reflux disease \| 1 C0021933 \| intussusception \| 1 C0007789 \| cerebral palsy \| 1 C0032290 \| aspiration pneumonia \| 1 C0018021 \| goiter \| 1 C0024314 \| lymphoproliferative disease \| 1 C2712893 \| swine flu \| 1 C0221757 \| alpha-1-antitrypsin deficiency \| 1 C0041327 \| pulmonary tuberculosis \| 1 C0036439 \| scoliosis \| 1 C0028754 \| obesity \| 1 C0027819 \| neuroblastoma \| 1 C0027709 \| nephrocalcinosis \| 1 C0034067 \| pulmonary emphysema \| 1 C0153500 \| heart ca \| 1 C0022661 \| chronic kidney disease \| 1 C0020598 \| hypoglycemia \| 1 C0035204 \| respiratory disease \| 1 C1140680 \| ovarian ca \| 1 C0041296 \| mycobacterium tuberculosis infection \| 1 C0024115 \| lung diseases \| 1 C0026850 \| muscular dystrophy \| 1 C1510471 \| hypovitaminosis \| 1 C0019360 \| zoster \| 1 C0600260 \| obstructive lung disease \| 1 C0031117 \| peripheral neuropathy \| 1 C0008312 \| biliary cirrhosis \| 1 C0032285 \| lung inflammation \| 1 C0022658 \| renal diseases \| 1 C0001197 \| acrodermatitis \| 1 C0598176 \| small airways disease \| 1 C0006277 \| bronchitis \| 1 C0151740 \| intracranial hypertension \| 1 C0003873 \| rheumatoid arthritis \| 1 C0221036 \| acrodermatitis enteropathica \| 1 C1510471 \| vitamin deficiency \| 1 C0456909 \| vision loss \| 1 C0023895 \| hepatic disease \| 1 C0026946 \| mycoses \| 1 C0042384 \| vasculitis \| 1 C0343386 \| clostridium difficile infection \| 1 C0008372 \| intrahepatic cholestasis \| 1 C0221757 \| alpha-1-antitrypsin def \| 1 C0036202 \| sarcoidosis \| 1 C0235974 \| pancreatic carcinoma \| 1 C0004509 \| azoospermia \| 1 C0001622 \| hypercortisolism \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:9) 7040 \| TGFB1 \| CLINVAR;CTD_human;ORPHANET 1080 \| CFTR \| CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT 6337 \| SCNN1A \| CTD_human 6338 \| SCNN1B \| CTD_human 6340 \| SCNN1G \| CTD_human 7132 \| TNFRSF1A \| CTD_human 51164 \| DCTN4 \| CTD_human;ORPHANET 22802 \| CLCA4 \| ORPHANET 6804 \| STX1A \| ORPHANET
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:63) 5243 \| ABCB1 \| CIPHER 4363 \| ABCC1 \| CIPHER 1636 \| ACE \| CIPHER 79602 \| ADIPOR2 \| CIPHER 154 \| ADRB2 \| CIPHER 186 \| AGTR2 \| CIPHER 57491 \| AHRR \| CIPHER 929 \| CD14 \| CIPHER 1006 \| CDH8 \| CIPHER 1080 \| CFTR \| CIPHER;CTD_human 1181 \| CLCN2 \| CIPHER 6372 \| CXCL6 \| CIPHER 1672 \| DEFB1 \| CIPHER 414325 \| DEFB103A \| CIPHER 140596 \| DEFB104A \| CIPHER 1906 \| EDN1 \| CIPHER 1907 \| EDN2 \| CIPHER 1908 \| EDN3 \| CIPHER 1910 \| EDNRB \| CIPHER 2729 \| GCLC \| CIPHER 2944 \| GSTM1 \| CIPHER 2947 \| GSTM3 \| CIPHER 2950 \| GSTP1 \| CIPHER 2952 \| GSTT1 \| CIPHER 3077 \| HFE \| CIPHER 3132 \| HLA-DRB9 \| CIPHER 3586 \| IL10 \| CIPHER 3552 \| IL1A \| CIPHER 3553 \| IL1B \| CIPHER 3554 \| IL1R1 \| CIPHER 3557 \| IL1RN \| CIPHER 3558 \| IL2 \| CIPHER 3569 \| IL6 \| CIPHER 4153 \| MBL2 \| CIPHER 100132286 \| NDUFB8P3 \| CIPHER 4842 \| NOS1 \| CIPHER 4843 \| NOS2 \| CIPHER 4846 \| NOS3 \| CIPHER 5029 \| P2RY2 \| CIPHER 5197 \| PF4V1 \| CIPHER 5742 \| PTGS1 \| CIPHER 5743 \| PTGS2 \| CIPHER 166824 \| RASSF6 \| CIPHER 6052 \| RNR1 \| CIPHER 6337 \| SCNN1A \| CIPHER;CTD_human 6338 \| SCNN1B \| CIPHER;CTD_human 6340 \| SCNN1G \| CIPHER;CTD_human 5265 \| SERPINA1 \| CIPHER 653509 \| SFTPA1 \| CIPHER 729238 \| SFTPA2 \| CIPHER 6441 \| SFTPD \| CIPHER 6510 \| SLC1A5 \| CIPHER 8671 \| SLC4A4 \| CIPHER 6547 \| SLC8A3 \| CIPHER 6890 \| TAP1 \| CIPHER 6891 \| TAP2 \| CIPHER 7018 \| TF \| CIPHER 7040 \| TGFB1 \| CIPHER;CTD_human 7099 \| TLR4 \| CIPHER 7100 \| TLR5 \| CIPHER 7124 \| TNF \| CIPHER 7132 \| TNFRSF1A \| CIPHER;CTD_human 51164 \| DCTN4 \| CTD_human
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:299) 2 \| A2M \| 1.408 \| DISEASES 340273 \| ABCB5 \| 1.819 \| DISEASES 4363 \| ABCC1 \| 2.034 \| DISEASES 1244 \| ABCC2 \| 1.119 \| DISEASES 10257 \| ABCC4 \| 1.364 \| DISEASES 10057 \| ABCC5 \| 1.765 \| DISEASES 6833 \| ABCC8 \| 2.044 \| DISEASES 60 \| ACTB \| 1.52 \| DISEASES 94 \| ACVRL1 \| 1.245 \| DISEASES 55811 \| ADCY10 \| 1.372 \| DISEASES 84890 \| ADO \| 3.03 \| DISEASES 125061 \| AFMID \| 1.114 \| DISEASES 174 \| AFP \| 2.041 \| DISEASES 177 \| AGER \| 1.805 \| DISEASES 10768 \| AHCYL1 \| 2.839 \| DISEASES 9465 \| AKAP7 \| 1.355 \| DISEASES 229 \| ALDOB \| 1.219 \| DISEASES 249 \| ALPL \| 1.087 \| DISEASES 250 \| ALPP \| 1.59 \| DISEASES 265 \| AMELX \| 1.218 \| DISEASES 279 \| AMY2A \| 1.027 \| DISEASES 280 \| AMY2B \| 1.946 \| DISEASES 55107 \| ANO1 \| 4.021 \| DISEASES 338440 \| ANO9 \| 1.469 \| DISEASES 302 \| ANXA2 \| 1.038 \| DISEASES 8907 \| AP1M1 \| 1.657 \| DISEASES 51074 \| APIP \| 2.433 \| DISEASES 116969 \| ART5 \| 1.224 \| DISEASES 522 \| ATP5J \| 2.042 \| DISEASES 537 \| ATP6AP1 \| 3.227 \| DISEASES 8678 \| BECN1 \| 1.09 \| DISEASES 7439 \| BEST1 \| 2.143 \| DISEASES 632 \| BGLAP \| 2.382 \| DISEASES 91653 \| BOC \| 1.079 \| DISEASES 51297 \| BPIFA1 \| 3.459 \| DISEASES 801 \| CALM1 \| 2.911 \| DISEASES 813 \| CALU \| 2.131 \| DISEASES 820 \| CAMP \| 3.26 \| DISEASES 834 \| CASP1 \| 1.475 \| DISEASES 857 \| CAV1 \| 1.263 \| DISEASES 885 \| CCK \| 2.99 \| DISEASES 6364 \| CCL20 \| 1.345 \| DISEASES 959 \| CD40LG \| 2.944 \| DISEASES 1084 \| CEACAM3 \| 1.504 \| DISEASES 23436 \| CELA3B \| 4.122 \| DISEASES 10659 \| CELF2 \| 1.195 \| DISEASES 1066 \| CES1 \| 1.362 \| DISEASES 629 \| CFB \| 2.28 \| DISEASES 3426 \| CFI \| 1.205 \| DISEASES 1118 \| CHIT1 \| 1.32 \| DISEASES 55847 \| CISD1 \| 2.086 \| DISEASES 9635 \| CLCA2 \| 4.967 \| DISEASES 22802 \| CLCA4 \| 5.066 \| DISEASES 23155 \| CLCC1 \| 2.07 \| DISEASES 1180 \| CLCN1 \| 1.334 \| DISEASES 1183 \| CLCN4 \| 1.386 \| DISEASES 1184 \| CLCN5 \| 2.087 \| DISEASES 728276 \| CLEC19A \| 1.911 \| DISEASES 1378 \| CR1 \| 1.112 \| DISEASES 1385 \| CREB1 \| 1.435 \| DISEASES 1471 \| CST3 \| 1.023 \| DISEASES 11330 \| CTRC \| 2.738 \| DISEASES 1508 \| CTSB \| 1.345 \| DISEASES 1520 \| CTSS \| 2.016 \| DISEASES 2919 \| CXCL1 \| 2.583 \| DISEASES 2920 \| CXCL2 \| 2.135 \| DISEASES 1576 \| CYP3A4 \| 1.485 \| DISEASES 10800 \| CYSLTR1 \| 1.014 \| DISEASES 1617 \| DAZ1 \| 1.132 \| DISEASES 85443 \| DCLK3 \| 1.785 \| DISEASES 9937 \| DCLRE1A \| 1.94 \| DISEASES 51164 \| DCTN4 \| 3.037 \| DISEASES 414325 \| DEFB103A \| 2.143 \| DISEASES 55894 \| DEFB103B \| 2.143 \| DISEASES 245909 \| DEFB106A \| 1.027 \| DISEASES 503841 \| DEFB106B \| 1.027 \| DISEASES 1755 \| DMBT1 \| 1.095 \| DISEASES 54788 \| DNAJB12 \| 1.18 \| DISEASES 22845 \| DOLK \| 1.644 \| DISEASES 26298 \| EHF \| 2.157 \| DISEASES 55250 \| ELP2 \| 1.08 \| DISEASES 2010 \| EMD \| 2.383 \| DISEASES 5169 \| ENPP3 \| 1.863 \| DISEASES 953 \| ENTPD1 \| 1.727 \| DISEASES 104355217 \| ERICD \| 3.138 \| DISEASES 2117 \| ETV3 \| 1.707 \| DISEASES 7430 \| EZR \| 1.601 \| DISEASES 2165 \| F13B \| 1.272 \| DISEASES 646480 \| FABP9 \| 1.246 \| DISEASES 84498 \| FAM120B \| 1.044 \| DISEASES 729533 \| FAM72A \| 1.647 \| DISEASES 23625 \| FAM89B \| 1.946 \| DISEASES 2318 \| FLNC \| 6.274 \| DISEASES 2302 \| FOXJ1 \| 2.332 \| DISEASES 2358 \| FPR2 \| 1.933 \| DISEASES 170384 \| FUT11 \| 1.793 \| DISEASES 2524 \| FUT2 \| 1.318 \| DISEASES 2638 \| GC \| 2.04 \| DISEASES 2641 \| GCG \| 1.803 \| DISEASES 2673 \| GFPT1 \| 2.243 \| DISEASES 728441 \| GGT2 \| 1.919 \| DISEASES 2695 \| GIP \| 1.922 \| DISEASES 2706 \| GJB2 \| 1.136 \| DISEASES 10052 \| GJC1 \| 1.352 \| DISEASES 51218 \| GLRX5 \| 1.308 \| DISEASES 346562 \| GNAT3 \| 2.171 \| DISEASES 57120 \| GOPC \| 4.079 \| DISEASES 2813 \| GP2 \| 1.702 \| DISEASES 160897 \| GPR180 \| 1.501 \| DISEASES 2934 \| GSN \| 2.503 \| DISEASES 2950 \| GSTP1 \| 1.267 \| DISEASES 2980 \| GUCA2A \| 3.146 \| DISEASES 3043 \| HBB \| 1.31 \| DISEASES 3066 \| HDAC2 \| 1.676 \| DISEASES 10013 \| HDAC6 \| 1.35 \| DISEASES 55127 \| HEATR1 \| 1.687 \| DISEASES 55733 \| HHAT \| 2.983 \| DISEASES 3119 \| HLA-DQB1 \| 1.173 \| DISEASES 3120 \| HLA-DQB2 \| 1.04 \| DISEASES 3146 \| HMGB1 \| 1.806 \| DISEASES 3240 \| HP \| 1.893 \| DISEASES 3320 \| HSP90AA1 \| 2.019 \| DISEASES 3329 \| HSPD1 \| 2.281 \| DISEASES 3423 \| IDS \| 1.257 \| DISEASES 3486 \| IGFBP3 \| 2.048 \| DISEASES 347252 \| IGFBPL1 \| 1.524 \| DISEASES 3586 \| IL10 \| 2.945 \| DISEASES 3605 \| IL17A \| 2.565 \| DISEASES 112744 \| IL17F \| 1.077 \| DISEASES 133396 \| IL31RA \| 1.466 \| DISEASES 54617 \| INO80 \| 1.688 \| DISEASES 3652 \| IPP \| 1.096 \| DISEASES 3654 \| IRAK1 \| 1.014 \| DISEASES 3684 \| ITGAM \| 1.856 \| DISEASES 3702 \| ITK \| 2.425 \| DISEASES 9445 \| ITM2B \| 1.211 \| DISEASES 50618 \| ITSN2 \| 1.473 \| DISEASES 3758 \| KCNJ1 \| 2.088 \| DISEASES 8645 \| KCNK5 \| 1.786 \| DISEASES 3778 \| KCNMA1 \| 1.434 \| DISEASES 3792 \| KEL \| 1.486 \| DISEASES 9622 \| KLK4 \| 1.476 \| DISEASES 11202 \| KLK8 \| 1.15 \| DISEASES 3875 \| KRT18 \| 2.118 \| DISEASES 3916 \| LAMP1 \| 1.636 \| DISEASES 3963 \| LGALS7 \| 1.803 \| DISEASES 3980 \| LIG3 \| 1.557 \| DISEASES 3996 \| LLGL1 \| 1.737 \| DISEASES 389816 \| LRRC26 \| 2.597 \| DISEASES 378938 \| MALAT1 \| 2.92 \| DISEASES 5599 \| MAPK8 \| 1.94 \| DISEASES 4082 \| MARCKS \| 2.237 \| DISEASES 4153 \| MBL2 \| 2.867 \| DISEASES 219541 \| MED19 \| 1.089 \| DISEASES 8972 \| MGAM \| 2.566 \| DISEASES 10724 \| MGEA5 \| 1.465 \| DISEASES 114614 \| MIR155HG \| 1.588 \| DISEASES 57591 \| MKL1 \| 1.371 \| DISEASES 4295 \| MLN \| 1.458 \| DISEASES 4312 \| MMP1 \| 1.074 \| DISEASES 4318 \| MMP9 \| 2.321 \| DISEASES 22921 \| MSRB2 \| 1.613 \| DISEASES 4582 \| MUC1 \| 2.486 \| DISEASES 4583 \| MUC2 \| 3.555 \| DISEASES 200958 \| MUC20 \| 1.798 \| DISEASES 100507679 \| MUC22 \| 1.758 \| DISEASES 4585 \| MUC4 \| 1.807 \| DISEASES 4586 \| MUC5AC \| 4.501 \| DISEASES 727897 \| MUC5B \| 5.485 \| DISEASES 4588 \| MUC6 \| 1.403 \| DISEASES 100129528 \| MUC8 \| 2.073 \| DISEASES 4615 \| MYD88 \| 2.278 \| DISEASES 4689 \| NCF4 \| 3.157 \| DISEASES 4703 \| NEB \| 2.976 \| DISEASES 4734 \| NEDD4 \| 1.745 \| DISEASES 23327 \| NEDD4L \| 2.281 \| DISEASES 58484 \| NLRC4 \| 1.191 \| DISEASES 4843 \| NOS2 \| 1.623 \| DISEASES 55666 \| NPLOC4 \| 1.68 \| DISEASES 100506658 \| OCLN \| 1.466 \| DISEASES 5032 \| P2RY11 \| 1.294 \| DISEASES 5030 \| P2RY4 \| 1.82 \| DISEASES 23241 \| PACS2 \| 1.174 \| DISEASES 164091 \| PAQR7 \| 1.552 \| DISEASES 8654 \| PDE5A \| 1.633 \| DISEASES 54704 \| PDP1 \| 1.198 \| DISEASES 79849 \| PDZD3 \| 2.339 \| DISEASES 5174 \| PDZK1 \| 1.68 \| DISEASES 23481 \| PES1 \| 2.393 \| DISEASES 5238 \| PGM3 \| 2.503 \| DISEASES 5251 \| PHEX \| 3.22 \| DISEASES 57649 \| PHF12 \| 2.493 \| DISEASES 9063 \| PIAS2 \| 1.445 \| DISEASES 5284 \| PIGR \| 1.161 \| DISEASES 5569 \| PKIA \| 1.058 \| DISEASES 5321 \| PLA2G4A \| 1.679 \| DISEASES 8605 \| PLA2G4C \| 1.826 \| DISEASES 5322 \| PLA2G5 \| 2.238 \| DISEASES 191585 \| PLAC4 \| 1.625 \| DISEASES 5406 \| PNLIP \| 3.352 \| DISEASES 5530 \| PPP3CA \| 2.022 \| DISEASES 5542 \| PRB1 \| 1.291 \| DISEASES 56980 \| PRDM10 \| 1.085 \| DISEASES 5627 \| PROS1 \| 2.061 \| DISEASES 5646 \| PRSS3 \| 2.851 \| DISEASES 400668 \| PRSS57 \| 1.605 \| DISEASES 136541 \| PRSS58 \| 3.059 \| DISEASES 5831 \| PYCR1 \| 1.897 \| DISEASES 5888 \| RAD51 \| 3.906 \| DISEASES 10411 \| RAPGEF3 \| 1.354 \| DISEASES 55147 \| RBM23 \| 1.294 \| DISEASES 56963 \| RGMA \| 1.495 \| DISEASES 6007 \| RHD \| 1.4 \| DISEASES 387 \| RHOA \| 1.29 \| DISEASES 6048 \| RNF5 \| 3.675 \| DISEASES 6136 \| RPL12 \| 1.042 \| DISEASES 6122 \| RPL3 \| 1.575 \| DISEASES 6232 \| RPS27 \| 1.556 \| DISEASES 221421 \| RSPH9 \| 1.399 \| DISEASES 6281 \| S100A10 \| 1.91 \| DISEASES 6283 \| S100A12 \| 2.3 \| DISEASES 6279 \| S100A8 \| 1.917 \| DISEASES 6280 \| S100A9 \| 2.212 \| DISEASES 9294 \| S1PR2 \| 1.103 \| DISEASES 6337 \| SCNN1A \| 3.48 \| DISEASES 6338 \| SCNN1B \| 3.795 \| DISEASES 6339 \| SCNN1D \| 2.37 \| DISEASES 10802 \| SEC24A \| 2.143 \| DISEASES 5265 \| SERPINA1 \| 4.664 \| DISEASES 1992 \| SERPINB1 \| 3.731 \| DISEASES 653509 \| SFTPA1 \| 2.549 \| DISEASES 729238 \| SFTPA2 \| 2.805 \| DISEASES 6439 \| SFTPB \| 1.996 \| DISEASES 6441 \| SFTPD \| 2.855 \| DISEASES 6446 \| SGK1 \| 2.247 \| DISEASES 22941 \| SHANK2 \| 1.024 \| DISEASES 59307 \| SIGIRR \| 1.07 \| DISEASES 25942 \| SIN3A \| 1.115 \| DISEASES 6565 \| SLC15A2 \| 1.46 \| DISEASES 10861 \| SLC26A1 \| 1.803 \| DISEASES 284129 \| SLC26A11 \| 2.615 \| DISEASES 1811 \| SLC26A3 \| 3.869 \| DISEASES 65010 \| SLC26A6 \| 4.413 \| DISEASES 116369 \| SLC26A8 \| 2.073 \| DISEASES 115019 \| SLC26A9 \| 4.429 \| DISEASES 285641 \| SLC36A3 \| 1.092 \| DISEASES 6522 \| SLC4A2 \| 2.099 \| DISEASES 8671 \| SLC4A4 \| 2.856 \| DISEASES 9498 \| SLC4A8 \| 1.109 \| DISEASES 11254 \| SLC6A14 \| 3.01 \| DISEASES 9351 \| SLC9A3R2 \| 3.193 \| DISEASES 6590 \| SLPI \| 4.05 \| DISEASES 4088 \| SMAD3 \| 1.553 \| DISEASES 6606 \| SMN1 \| 1.397 \| DISEASES 6607 \| SMN2 \| 1.476 \| DISEASES 6609 \| SMPD1 \| 2.661 \| DISEASES 9304 \| SNORD22 \| 1.004 \| DISEASES 54345 \| SOX18 \| 1.04 \| DISEASES 25803 \| SPDEF \| 1.88 \| DISEASES 8878 \| SQSTM1 \| 1.242 \| DISEASES 6714 \| SRC \| 1.535 \| DISEASES 84620 \| ST6GAL2 \| 1.14 \| DISEASES 6772 \| STAT1 \| 1.255 \| DISEASES 25870 \| SUMF2 \| 3.806 \| DISEASES 258010 \| SVIP \| 1.55 \| DISEASES 54823 \| SWT1 \| 1.267 \| DISEASES 94122 \| SYTL5 \| 1.334 \| DISEASES 84447 \| SYVN1 \| 2.394 \| DISEASES 6863 \| TAC1 \| 1.619 \| DISEASES 441864 \| TARM1 \| 1.304 \| DISEASES 50840 \| TAS2R14 \| 1.381 \| DISEASES 259295 \| TAS2R20 \| 1.869 \| DISEASES 5726 \| TAS2R38 \| 2.337 \| DISEASES 7018 \| TF \| 2.554 \| DISEASES 7037 \| TFRC \| 1.281 \| DISEASES 7052 \| TGM2 \| 1.918 \| DISEASES 26520 \| TIMM9 \| 1.005 \| DISEASES 7096 \| TLR1 \| 1.547 \| DISEASES 7099 \| TLR4 \| 3.193 \| DISEASES 7100 \| TLR5 \| 3.467 \| DISEASES 7114 \| TMSB4X \| 1.016 \| DISEASES 7124 \| TNF \| 4.099 \| DISEASES 10043 \| TOM1 \| 1.516 \| DISEASES 7189 \| TRAF6 \| 1.106 \| DISEASES 10345 \| TRDN \| 1.476 \| DISEASES 51592 \| TRIM33 \| 1.147 \| DISEASES 7225 \| TRPC6 \| 1.764 \| DISEASES 7295 \| TXN \| 1.017 \| DISEASES 10422 \| UBAC1 \| 1.675 \| DISEASES 7316 \| UBC \| 1.189 \| DISEASES 7329 \| UBE2I \| 1.054 \| DISEASES 51465 \| UBE2J1 \| 1.361 \| DISEASES 7421 \| VDR \| 1.034 \| DISEASES 7422 \| VEGFA \| 1.23 \| DISEASES 7432 \| VIP \| 3.203 \| DISEASES 23038 \| WDTC1 \| 2.826 \| DISEASES 55625 \| ZDHHC7 \| 1.374 \| DISEASES 57178 \| ZMIZ1 \| 1.301 \| DISEASES 7633 \| ZNF79 \| 2.235 \| DISEASES
Locus	Symbol \| Locus(Total Locus:5) CLCA4 \| 1p22.3 DCTN4 \| 5q33.1 CFTR \| 7q31.2 TGFB1 \| 19q13.1 STX1A \| 7q11.23

Disease ID	38
Disease	cystic fibrosis
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:21) HP:0001738 \| Exocrine pancreatic insufficiency HP:0006532 \| Pneumonia, recurrent episodes HP:0006528 \| Chronic lung disease HP:0002240 \| Hepatomegaly HP:0002110 \| Bronchiectasis HP:0002721 \| Immunodeficiency HP:0002613 \| Biliary cirrhosis HP:0002206 \| Pulmonary fibrosis HP:0004313 \| Decreased antibody level in blood HP:0001648 \| Cor pulmonale HP:0001508 \| Weight faltering HP:0003251 \| Male infertility HP:0002150 \| Hypercalcinuria HP:0001944 \| Dehydration HP:0006538 \| Recurrent bronchopulmonary infections HP:0004401 \| Meconium ileus HP:0012236 \| Elevated sweat chloride HP:0002099 \| Asthma HP:0002035 \| Rectal prolapse HP:0002024 \| Malabsorption HP:0002205 \| Recurrent respiratory infections
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:144) HP:0006532 \| Pneumonia, recurrent episodes \| 27 HP:0011947 \| Respiratory infection \| 19 HP:0002783 \| Chronic lung infections \| 18 HP:0100582 \| Nasal polyps \| 12 HP:0002110 \| Bronchiectasis \| 11 HP:0001733 \| Pancreatic inflammation \| 10 HP:0002090 \| Pneumonia \| 9 HP:0002595 \| Gastrointestinal atony \| 9 HP:0004401 \| Meconium ileus \| 8 HP:0002024 \| Intestinal malabsorption \| 7 HP:0001738 \| Exocrine pancreatic insufficiency \| 7 HP:0012531 \| Pain \| 6 HP:0000822 \| Hypertension \| 6 HP:0002020 \| Heartburn \| 6 HP:0000939 \| Osteoporosis \| 5 HP:0000716 \| Depression \| 5 HP:0006280 \| Chronic pancreas inflammation \| 5 HP:0100512 \| Vitamin D deficiency \| 5 HP:0005214 \| Bowel obstruction \| 4 HP:0002019 \| Dyschezia \| 4 HP:0002105 \| Hemoptysis \| 4 HP:0000833 \| Glucose intolerance \| 4 HP:0002630 \| Fat malabsorption \| 4 HP:0004395 \| Malnutrition \| 4 HP:0002099 \| Asthma \| 4 HP:0002878 \| Respiratory failure \| 4 HP:0001510 \| Growth deficiency \| 4 HP:0002206 \| Pulmonary fibrosis \| 4 HP:0200114 \| Metabolic alkalosis \| 4 HP:0002092 \| Pulmonary artery hypertension \| 4 HP:0002027 \| Abdominal pain \| 4 HP:0001948 \| Alkalosis \| 3 HP:0001903 \| Anemia \| 3 HP:0000083 \| Renal insufficiency \| 3 HP:0002608 \| Celiac disease \| 3 HP:0002107 \| Collapsed lung \| 3 HP:0000819 \| Diabetes mellitus \| 3 HP:0002097 \| Pulmonary emphysema \| 3 HP:0012735 \| Coughing \| 3 HP:0002583 \| Colitis \| 3 HP:0001396 \| Cholestasis \| 3 HP:0001369 \| Arthritis \| 3 HP:0000739 \| Anxiety \| 3 HP:0002835 \| Aspiration \| 3 HP:0003074 \| High blood glucose \| 2 HP:0003546 \| Exercise intolerance \| 2 HP:0001395 \| Hepatic fibrosis \| 2 HP:0001944 \| Dehydration \| 2 HP:0000969 \| Dropsy \| 2 HP:0030828 \| Wheezing \| 2 HP:0006528 \| Chronic lung disease \| 2 HP:0000982 \| Palmoplantar keratoderma \| 2 HP:0000020 \| Bladder incontinence \| 2 HP:0011950 \| Bronchiolitis \| 2 HP:0006510 \| Chronic obstructive pulmonary disease \| 2 HP:0001371 \| Flexion contractures of joints \| 2 HP:0000846 \| Hypoadrenalism \| 2 HP:0002149 \| Hyperuricemia \| 2 HP:0000159 \| Lip abnormality \| 2 HP:0000246 \| Sinus inflammation \| 2 HP:0030731 \| Carcinoma \| 2 HP:0000024 \| Inflammation of the prostate \| 2 HP:0002242 \| Enteropathy \| 1 HP:0002901 \| Hypocalcemia \| 1 HP:0001262 \| Somnolence \| 1 HP:0100033 \| Tic disorder \| 1 HP:0002035 \| Rectal prolapse \| 1 HP:0005235 \| Jejunal atresia \| 1 HP:0009830 \| Peripheral neuritis \| 1 HP:0002900 \| Hypokalemia \| 1 HP:0002665 \| Lymphoma \| 1 HP:0012532 \| Chronic pain \| 1 HP:0002516 \| Intracranial pressure elevation \| 1 HP:0007099 \| Arnold Chiari type I malformation \| 1 HP:0002613 \| Biliary cirrhosis \| 1 HP:0001917 \| Renal amyloidosis \| 1 HP:0010943 \| Echogenic bowel \| 1 HP:0002094 \| Dyspnea \| 1 HP:0001824 \| Weight loss \| 1 HP:0100724 \| Hypercoagulability \| 1 HP:0100583 \| Corneal perforation \| 1 HP:0001270 \| Motor retardation \| 1 HP:0002586 \| Peritonitis \| 1 HP:0012418 \| Low blood oxygen level \| 1 HP:0000787 \| Renal calculi \| 1 HP:0000572 \| Visual loss \| 1 HP:0002719 \| infections, recurrent \| 1 HP:0002902 \| Hyponatremia \| 1 HP:0012378 \| Fatigue \| 1 HP:0001289 \| Confusion \| 1 HP:0011951 \| Aspiration pneumonia \| 1 HP:0006536 \| Obstructive lung disease \| 1 HP:0001397 \| Hepatic steatosis \| 1 HP:0000821 \| Underactive thyroid \| 1 HP:0001649 \| Tachycardia \| 1 HP:0011034 \| Amyloid disease \| 1 HP:0100790 \| Hernia \| 1 HP:0012189 \| Hodgkin disease \| 1 HP:0001907 \| Thromboembolic disease \| 1 HP:0012594 \| High urine albumin levels \| 1 HP:0002650 \| Scoliosis \| 1 HP:0002910 \| Elevated transaminases \| 1 HP:0012622 \| Chronic kidney disease \| 1 HP:0012636 \| Retinal vein occlusion \| 1 HP:0001952 \| Abnormal glucose tolerance \| 1 HP:0001943 \| Hypoglycemia \| 1 HP:0002039 \| Anorexia \| 1 HP:0002958 \| Immune dysregulation \| 1 HP:0002576 \| Intussusception \| 1 HP:0005952 \| Decreased lung function \| 1 HP:0005202 \| Helicobacter pylori infection \| 1 HP:0001578 \| Hypercortisolism \| 1 HP:0001406 \| Intrahepatic cholestasis \| 1 HP:0003006 \| Neuroblastoma \| 1 HP:0002664 \| Neoplasia \| 1 HP:0003560 \| Muscular dystrophy \| 1 HP:0002779 \| Tracheomalacia \| 1 HP:0001259 \| Coma \| 1 HP:0001081 \| Gallstones \| 1 HP:0001394 \| Hepatic cirrhosis \| 1 HP:0004322 \| Stature below 3rd percentile \| 1 HP:0000992 \| Skin photosensitivity \| 1 HP:0003251 \| Male infertility \| 1 HP:0004469 \| Chronic bronchitis \| 1 HP:0002754 \| Bone infection \| 1 HP:0001513 \| Obesity \| 1 HP:0000121 \| Nephrocalcinosis \| 1 HP:0002894 \| Neoplasia of the pancreas \| 1 HP:0000853 \| Goitre \| 1 HP:0000855 \| Insulin resistance \| 1 HP:0012393 \| Allergy \| 1 HP:0001618 \| Dysphonia \| 1 HP:0012649 \| Increased inflammatory response \| 1 HP:0001548 \| Overgrowth \| 1 HP:0001370 \| Rheumatoid arthritis \| 1 HP:0000113 \| Polycystic kidney dysplasia \| 1 HP:0100021 \| Cerebral palsy \| 1 HP:0100750 \| Pulmonary atelectasis \| 1 HP:0003396 \| Syringomyelia \| 1 HP:0000027 \| Azoospermia \| 1 HP:0001409 \| Portal hypertension \| 1 HP:0000776 \| Diaphragmatic hernia \| 1 HP:0012387 \| Bronchitis \| 1 HP:0002633 \| Vasculitis \| 1

Disease ID	38
Disease	cystic fibrosis
Manually Symptom	UMLS \| Name(Total Manually Symptoms:438) C2712340 \| dyspnoea C2712335 \| dehydration C2712331 \| urinary incontinence C2712322 \| tachycardia C2712035 \| hyperglycaemia C2707258 \| infections C2707011 \| behavioral symptoms C2700565 \| pancreatic cancer C2697384 \| colon cancer C2678504 \| osteoporosis C2632116 \| stenosis C2609095 \| alcaligenes infection C2585575 \| recurrent abdominal pain C2364324 \| increased intracranial pressure C2364133 \| infection C2364119 \| failure to thrive C2364072 \| depression C2350529 \| pulmonary aspergillosis C2242492 \| lower airway obstruction C2203646 \| jaundice C2186740 \| urticaria C2186532 \| liver disease C2107732 \| heat intolerance C2062979 \| spontaneous bacterial peritonitis C2048468 \| male infertility C2046390 \| neonatal jaundice C2029884 \| hearing loss C2020637 \| chronic pain C2004461 \| bowel dysfunction C1998122 \| chronic respiratory insufficiency C1994997 \| intestinal symptoms C1963244 \| supraventricular tachycardia C1963220 \| pulmonary hypertension C1963215 \| pneumothorax C1963198 \| pancreatitis C1963165 \| malabsorption C1963106 \| esophagitis C1963087 \| constipation C1962972 \| proteinuria C1962966 \| retinopathy C1962953 \| dry eye syndrome C1961131 \| cough C1834174 \| neutrophil migration C1801950 \| g syndrome C1735378 \| chronic polyarthritis C1704275 \| pyomyositis C1699655 \| ileal fistula C1623038 \| cirrhosis C1611280 \| allergy C1610617 \| burkholderia cepacia infections C1610617 \| burkholderia cepacia infection C1608955 \| mycobacterium abscessus infection C1565489 \| renal insufficiency C1555769 \| pulmonary disease C1550639 \| fistula C1548335 \| food allergy C1548333 \| drug allergy C1546533 \| abscess C1522136 \| hypernatremia C1512411 \| hepatocellular carcinoma C1510428 \| cerebral abscess C1510420 \| cavities C1504665 \| diabetic ketoacidosis C1442864 \| diabetic nephropathy C1393529 \| vascular complications C1373218 \| immunosuppression C1368829 \| hyperalimentation C1321581 \| bezoars C1321542 \| azoospermia C1318973 \| staphylococcus aureus infection C1301752 \| respiratory morbidity C1257958 \| glucose metabolism disorders C1257843 \| pseudomembranous colitis C1145670 \| respiratory failure C1112565 \| pneumatosis intestinalis C1096584 \| chlamydia pneumoniae infection C1096000 \| bronchopulmonary disease C1090821 \| sepsis C1000483 \| anemia C0948783 \| bronchopulmonary infection C0948780 \| rhinosinusitis C0948267 \| fibrosing colonopathy C0947622 \| gallstones C0878787 \| growth failure C0878544 \| myocardiopathy C0878544 \| cardiomyopathy C0876973 \| pulmonary infections C0876973 \| pulmonary infection C0876973 \| lung infection C0860204 \| cholestatic liver disease C0860006 \| hypotonic dehydration C0859974 \| neonatal intestinal obstruction C0859235 \| leg discomfort C0858214 \| calcium abnormality C0854440 \| fatty acid deficiency C0854328 \| anaerobic bacterial infection C0854135 \| pseudomonas aeruginosa infection C0853277 \| pseudo-bartter syndrome C0851807 \| aspergillus infections C0851578 \| sleep disturbances C0850666 \| helicobacter pylori infection C0849777 \| cystic ovaries C0748164 \| multiple pulmonary nodules C0748159 \| pulmonary involvement C0746102 \| chronic lung disease C0741103 \| antibiotic allergy C0740394 \| hyperuricemia C0700361 \| distress C0700208 \| scoliosis C0699949 \| airways disease C0699949 \| airway disease C0699790 \| colon carcinoma C0600260 \| obstructive lung disease C0600260 \| obstructive airway disease C0598689 \| microbial colonization C0598176 \| small airways disease C0582430 \| adenocarcinoma of the ileum C0558976 \| gallbladder disease C0547030 \| visual disturbances C0546982 \| meconium ileus C0520743 \| mediastinal lymphadenopathy C0517555 \| venous thrombosis C0497552 \| nervous system abnormalities C0494752 \| diaphragmatic hernia C0476270 \| cardiovascular symptoms C0451641 \| urolithiasis C0442886 \| secondary infection C0426576 \| gastrointestinal symptoms C0426317 \| gut symptoms C0422833 \| ent symptoms C0409651 \| seropositive rheumatoid arthritis C0403474 \| microscopic nephrocalcinosis C0400979 \| biliary obstruction C0398673 \| sarcoid arthropathy C0398349 \| meconium ileus equivalent C0398349 \| distal intestinal obstruction syndrome C0392525 \| nephrolithiasis C0349006 \| staphylococcus aureus septicaemia C0346627 \| bowel cancer C0343440 \| pulmonary melioidosis C0343401 \| methicillin-resistant staphylococcus aureus infection C0342257 \| diabetic complications C0341697 \| renal impairment C0341471 \| idiopathic chronic pancreatitis C0341439 \| chronic liver disease C0340238 \| bronchial infection C0340231 \| bronchomalacia C0339901 \| acute respiratory infections C0339901 \| acute respiratory infection C0338106 \| colonic adenocarcinoma C0334108 \| polyposis C0314719 \| dry eye C0300933 \| phycomycosis C0281479 \| systemic amyloidosis C0281361 \| pancreatic adenocarcinoma C0277787 \| social stigmata C0276655 \| aspergillus fumigatus infection C0276651 \| aspergilloma C0276075 \| infection due to pseudomonas aeruginosa C0275583 \| pulmonary nocardiosis C0275578 \| nocardia asteroides infection C0275518 \| acute infection C0271898 \| relative anaemia C0271728 \| secondary hyperaldosteronism C0271711 \| spontaneous hypoglycemia C0271650 \| impaired glucose tolerance C0271650 \| glucose intolerance C0270327 \| nocturnal enuresis C0270250 \| meconium peritonitis C0270217 \| inspissated bile syndrome C0268382 \| nephropathic amyloidosis C0267963 \| pancreatic insufficiency C0267963 \| exocrine pancreatic insufficiency C0267937 \| recurrent acute pancreatitis C0267925 \| bile duct stenosis C0267792 \| hepatobiliary disorders C0267792 \| hepatobiliary disease C0267466 \| colonic stricture C0265673 \| kyphosis C0264515 \| necrotic pneumonia C0264490 \| acute respiratory failure C0264383 \| organizing pneumonia C0264233 \| paranasal sinus mucocele C0264220 \| chronic respiratory disease C0263610 \| solar urticaria C0262988 \| cutaneous vasculitis C0262471 \| ent problem C0242422 \| parkinsonism C0241885 \| exercise intolerance C0241771 \| periappendiceal abscess C0241235 \| purulent sputum C0240066 \| iron deficiency C0239946 \| liver fibrosis C0238106 \| clostridium difficile colitis C0238074 \| cor pulmonale C0238002 \| appendix abscess C0238002 \| appendiceal abscess C0235974 \| pancreatic carcinoma C0235401 \| abnormal glucose tolerance C0235394 \| wasting C0235329 \| small bowel obstruction C0235259 \| subcapsular cataracts C0234428 \| impaired consciousness C0232492 \| upper abdominal pain C0232305 \| right ventricular hypertrophy C0231819 \| air trapping C0231243 \| early complication C0221230 \| emphysematous cystitis C0221014 \| secondary amyloidosis C0221014 \| reactive systemic amyloidosis C0220983 \| metabolic alkalosis C0206698 \| cholangiocarcinoma C0178703 \| hypertrophic osteoarthropathy C0162429 \| undernutrition C0162429 \| malnutrition C0155860 \| pseudomonas pneumonia C0155789 \| bleeding esophageal varices C0153251 \| pulmonary candidiasis C0152166 \| pancreatic steatorrhoea C0151882 \| purpuric rashes C0151825 \| skeletal pain C0151723 \| hypomagnesemia C0151317 \| chronic infection C0149781 \| spontaneous pneumothorax C0149725 \| lower respiratory tract infections C0149725 \| lower respiratory tract infection C0149725 \| chest infection C0149711 \| hilar adenopathy C0149521 \| chronic pancreatitis C0149516 \| chronic sinusitis C0149516 \| chronic rhinosinusitis C0149514 \| bronchitis C0086438 \| hypogammaglobulinemia C0085819 \| antibiotic-associated colitis C0085693 \| acute appendicitis C0085129 \| bronchial hyperreactivity C0085129 \| bronchial hyperactivity C0043349 \| conjunctival xerosis C0042928 \| vocal cord paralysis C0042880 \| vitamin k deficiency C0042875 \| vitamin e deficiency C0042870 \| vitamin d deficiency C0042847 \| vitamin b12 deficiency C0042847 \| vitamin b 12 deficiency C0042769 \| viral infections C0042769 \| viral infection C0042345 \| varices C0041912 \| upper respiratory tract infections C0041327 \| pulmonary tuberculosis C0040188 \| tic disorder C0040053 \| thrombosis C0038833 \| svc obstruction C0038833 \| superior vena cava syndrome C0038833 \| superior vena cava obstruction C0038826 \| superinfections C0038826 \| superinfection C0038238 \| steatorrhoea C0038238 \| steatorrhea C0038160 \| staphylococcal infections C0038160 \| staphylococcal infection C0037315 \| sleep-disordered breathing C0037315 \| sleep disordered breathing C0037199 \| sinusitis C0037176 \| single gene defect C0037090 \| respiratory symptoms C0037090 \| pulmonary symptoms C0036690 \| septicaemia C0035528 \| riboflavin deficiency C0035455 \| rhinitis C0035281 \| retention cyst C0035243 \| respiratory tract infections C0035243 \| respiratory tract infection C0035243 \| respiratory infections C0035243 \| respiratory infection C0035242 \| respiratory tract disease C0035229 \| respiratory insufficiency C0035204 \| respiratory disorders C0035204 \| respiratory disease C0034888 \| rectal prolapse C0034150 \| purpura C0033845 \| pseudotumor cerebri C0033817 \| pseudomonas infections C0033817 \| pseudomonas infection C0033817 \| pseudomonal infections C0033677 \| protein-energy malnutrition C0032285 \| pulmonary inflammation C0032285 \| pneumonitis C0032285 \| pneumonias C0032285 \| pneumonia C0032285 \| lung inflammation C0032266 \| pneumatosis coli C0030920 \| peptic ulcer disease C0030469 \| paranasal sinus disease C0030286 \| pancreatic disorders C0030286 \| pancreatic disease C0029882 \| otitis media C0029878 \| external otitis C0029442 \| osteomalacia C0029412 \| hypertrophic pulmonary osteoarthropathy C0029128 \| optic nerve drusen C0029118 \| opportunistic infections C0028709 \| nutritional disorders C0028432 \| nasal disease C0028077 \| night blindness C0027709 \| nephrocalcinosis C0026946 \| fungal infections C0026919 \| atypical mycobacterial infection C0026918 \| mycobacterial infection C0026916 \| mycobacterium avium complex C0026846 \| muscle wasting C0026709 \| arylsulphatase b deficiency C0026684 \| appendicular mucocele C0026684 \| appendiceal mucocele C0026683 \| mucocele C0026650 \| movement disorders C0025945 \| diabetic microangiopathy C0025517 \| metabolic disorder C0025229 \| melioidosis C0024523 \| intestinal malabsorption C0024473 \| magnesium deficiency C0024117 \| chronic obstructive pulmonary disease C0024115 \| lung disorders C0024115 \| lung disease C0024110 \| lung abscess C0023895 \| hepatic disease C0023892 \| biliary cirrhosis C0023890 \| liver cirrhosis C0023890 \| hepatic cirrhosis C0023890 \| cirrhosis of the liver C0023241 \| legionnaires' disease C0022735 \| xxy klinefelter's syndrome C0022660 \| acute renal failure C0022658 \| renal disease C0022658 \| nephropathy C0022596 \| palmoplantar keratoderma C0022408 \| joint disorders C0022408 \| arthropathy C0022408 \| arthropathies C0021933 \| intussusception C0021843 \| intestinal obstructions C0021843 \| intestinal obstruction C0021843 \| bowel obstruction C0021831 \| intestinal disease C0021831 \| enteropathy C0021831 \| bowel disease C0021400 \| influenzae C0021359 \| infertility C0020676 \| hypothyroidism C0020625 \| hyponatremia C0020598 \| hypocalcemia C0020541 \| portal hypertension C0020514 \| hyperprolactinaemia C0020455 \| hypergammaglobulinemia C0020440 \| hypercapnia C0020438 \| hypercalciuria C0020437 \| hypercalcaemia C0019212 \| hepatorenal failure C0019163 \| hepatitis b infection C0019114 \| hemosiderosis C0019080 \| hemorrhage C0019079 \| hemoptysis C0019079 \| haemoptysis C0018801 \| heart failure C0018784 \| sensorineural hearing loss C0018483 \| haemophilus influenzae C0018482 \| haemophilus infections C0018482 \| haemophilus infection C0018418 \| gynaecomastia C0018021 \| goiter C0017667 \| nodular glomerulosclerosis C0017662 \| membranoproliferative glomerulonephritis C0017661 \| iga nephropathy C0017536 \| giardiasis C0017178 \| gastrointestinal diseases C0017168 \| gastroesophageal reflux disease C0017168 \| gastroesophageal reflux C0017168 \| gastro-oesophageal reflux C0017105 \| clostridial myonecrosis C0016977 \| biliary disease C0015732 \| fecal incontinence C0015695 \| fatty liver C0015411 \| eye manifestations C0015300 \| proptosis C0015230 \| rash C0014867 \| esophageal varices C0014009 \| empyema C0013473 \| eating disorders C0013447 \| ear diseases C0013404 \| breathlessness C0013289 \| duodenal disease C0011860 \| diabetes C0011854 \| type i diabetes mellitus C0011854 \| insulin dependent diabetes mellitus C0011849 \| diabetes mellitus C0011616 \| contact dermatitis C0011334 \| dental caries C0010416 \| cryptococcus neoformans C0010356 \| cross infection C0010346 \| crohn's disease C0010308 \| congenital hypothyroidism C0010200 \| coughing C0009373 \| colonic disease C0008372 \| intrahepatic cholestasis C0008370 \| cholestasis C0008370 \| bile duct obstruction C0008313 \| sclerosing cholangitis C0008031 \| chest pain C0007861 \| cervicitis C0007570 \| celiac disease C0006664 \| calcinosis cutis C0006625 \| cachexia C0006271 \| bronchiolitis C0006267 \| bronchiectasis C0006266 \| bronchospasm C0006105 \| brain abscess C0005940 \| bone disease C0005424 \| biliary tract disease C0004775 \| bartter's syndrome C0004623 \| bacterial infections C0004623 \| bacterial infection C0004610 \| bacteremia C0004096 \| asthma C0004096 \| airway hyperreactivity C0004032 \| disseminated aspergillosis C0004031 \| allergic bronchopulmonary aspergillosis C0004030 \| aspergillosis C0003864 \| arthritis C0003615 \| appendicitis C0002726 \| amyloidosis C0002453 \| amenorrhoea C0002063 \| alkalosis C0001883 \| airways obstruction C0001883 \| airway obstruction C0001486 \| adenovirus infections C0001486 \| adenovirus infection C0001418 \| adenocarcinoma C0001339 \| acute pancreatitis C0000737 \| abdominal pain
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:157) C0021311 \| infections \| 163 C0009450 \| infection \| 124 C0876973 \| lung infection \| 71 C0024115 \| lung disease \| 65 C0854135 \| pseudomonas aeruginosa infection \| 28 C2350529 \| pulmonary aspergillosis \| 21 C0004031 \| allergic bronchopulmonary aspergillosis \| 20 C0004030 \| aspergillosis \| 20 C0151317 \| chronic infection \| 17 C0024115 \| pulmonary disease \| 16 C0030293 \| pancreatic insufficiency \| 15 C0011847 \| diabetes \| 15 C0023895 \| liver disease \| 14 C0876973 \| pulmonary infections \| 14 C0876973 \| pulmonary infection \| 12 C0006267 \| bronchiectasis \| 11 C0030305 \| pancreatitis \| 10 C0035243 \| respiratory infection \| 9 C0334108 \| polyposis \| 9 C0032285 \| pneumonia \| 8 C0004623 \| bacterial infection \| 8 C0270246 \| meconium ileus \| 8 C0024523 \| malabsorption \| 7 C0267963 \| exocrine pancreatic insufficiency \| 7 C0029456 \| osteoporosis \| 5 C0149521 \| chronic pancreatitis \| 5 C0042870 \| vitamin d deficiency \| 5 C0011570 \| depression \| 5 C0005940 \| bone disease \| 5 C0271650 \| glucose intolerance \| 4 C0000737 \| abdominal pain \| 4 C0020542 \| pulmonary hypertension \| 4 C0029118 \| opportunistic infections \| 4 C0017168 \| gastroesophageal reflux \| 4 C0162429 \| malnutrition \| 4 C0220983 \| metabolic alkalosis \| 4 C0004096 \| asthma \| 4 C0019079 \| hemoptysis \| 4 C0035243 \| respiratory tract infection \| 4 C0037090 \| respiratory symptoms \| 4 C0009806 \| constipation \| 4 C0035243 \| respiratory tract infections \| 3 C0948780 \| rhinosinusitis \| 3 C0002063 \| alkalosis \| 3 C1994997 \| intestinal symptoms \| 3 C0033817 \| pseudomonas infection \| 3 C1145670 \| respiratory failure \| 3 C0003864 \| arthritis \| 3 C0008370 \| cholestasis \| 3 C0007570 \| celiac disease \| 3 C0035243 \| respiratory infections \| 3 C0032326 \| pneumothorax \| 3 C0149516 \| chronic rhinosinusitis \| 3 C0021843 \| intestinal obstruction \| 3 C0037090 \| pulmonary symptoms \| 3 C0011849 \| diabetes mellitus \| 3 C0002871 \| anemia \| 3 C0231303 \| distress \| 3 C1565489 \| renal insufficiency \| 2 C0010200 \| cough \| 2 C0022658 \| renal disease \| 2 C0006271 \| bronchiolitis \| 2 C0023895 \| hepatic disease \| 2 C0238106 \| clostridium difficile colitis \| 2 C0341697 \| renal impairment \| 2 C0024117 \| chronic obstructive pulmonary disease \| 2 C0037199 \| sinusitis \| 2 C0241885 \| exercise intolerance \| 2 C0022596 \| palmoplantar keratoderma \| 2 C0699949 \| airway disease \| 2 C0042024 \| urinary incontinence \| 2 C0878787 \| growth failure \| 2 C0019079 \| haemoptysis \| 2 C0011175 \| dehydration \| 2 C0042769 \| viral infections \| 2 C0001883 \| airway obstruction \| 2 C1318973 \| staphylococcus aureus infection \| 2 C0746102 \| chronic lung disease \| 2 C0004610 \| bacteremia \| 2 C0017168 \| gastro-oesophageal reflux \| 2 C0006277 \| bronchitis \| 1 C0041327 \| pulmonary tuberculosis \| 1 C0032285 \| pulmonary inflammation \| 1 C0008312 \| biliary cirrhosis \| 1 C0035204 \| respiratory disease \| 1 C0023890 \| cirrhosis \| 1 C0036439 \| scoliosis \| 1 C0020541 \| portal hypertension \| 1 C0264220 \| chronic respiratory disease \| 1 C0341471 \| idiopathic chronic pancreatitis \| 1 C0008372 \| intrahepatic cholestasis \| 1 C0850666 \| helicobacter pylori infection \| 1 C0853277 \| pseudo-bartter syndrome \| 1 C0026918 \| mycobacterial infection \| 1 C0033817 \| pseudomonal infections \| 1 C0010200 \| coughing \| 1 C0002726 \| amyloidosis \| 1 C0398349 \| meconium ileus equivalent \| 1 C0032285 \| lung inflammation \| 1 C0037315 \| sleep-disordered breathing \| 1 C0017168 \| gastroesophageal reflux disease \| 1 C0042769 \| viral infection \| 1 C0018021 \| goiter \| 1 C0039231 \| tachycardia \| 1 C0235974 \| pancreatic carcinoma \| 1 C0392525 \| nephrolithiasis \| 1 C0020676 \| hypothyroidism \| 1 C0740394 \| hyperuricemia \| 1 C0231819 \| air trapping \| 1 C0235329 \| small bowel obstruction \| 1 C0008350 \| gallstones \| 1 C0340238 \| bronchial infection \| 1 C0598176 \| small airways disease \| 1 C0014599 \| epithelial hyperplasia \| 1 C0235974 \| pancreatic cancer \| 1 C0015230 \| rash \| 1 C0150055 \| chronic pain \| 1 C0021079 \| immunosuppression \| 1 C0040188 \| tic disorder \| 1 C2585575 \| recurrent abdominal pain \| 1 C0748159 \| pulmonary involvement \| 1 C0948783 \| bronchopulmonary infection \| 1 C0021843 \| bowel obstruction \| 1 C0013404 \| breathlessness \| 1 C0275518 \| acute infection \| 1 C0235401 \| abnormal glucose tolerance \| 1 C1096000 \| bronchopulmonary disease \| 1 C0021400 \| influenzae \| 1 C0002111 \| allergy \| 1 C0021933 \| intussusception \| 1 C0271672 \| diabetic complications \| 1 C0019284 \| diaphragmatic hernia \| 1 C0426576 \| gastrointestinal symptoms \| 1 C0149725 \| lower respiratory tract infection \| 1 C0020598 \| hypocalcemia \| 1 C0030286 \| pancreatic disease \| 1 C1384666 \| hearing loss \| 1 C0398349 \| distal intestinal obstruction syndrome \| 1 C0004775 \| bartter's syndrome \| 1 C1257843 \| pseudomembranous colitis \| 1 C0021364 \| male infertility \| 1 C0042345 \| varices \| 1 C0018483 \| haemophilus influenzae \| 1 C0699949 \| airways disease \| 1 C0020625 \| hyponatremia \| 1 C0004509 \| azoospermia \| 1 C0021831 \| enteropathy \| 1 C1608955 \| mycobacterium abscessus infection \| 1 C0341439 \| chronic liver disease \| 1 C0025517 \| metabolic disorder \| 1 C0001418 \| adenocarcinoma \| 1 C0600260 \| obstructive lung disease \| 1 C0264490 \| acute respiratory failure \| 1 C1301752 \| respiratory morbidity \| 1 C0343401 \| methicillin-resistant staphylococcus aureus infection \| 1 C0422833 \| ent symptoms \| 1 C0027709 \| nephrocalcinosis \| 1

Manually Genotype(Total Manually Genotypes:28)
Gene	Mutation	DOI	Article Title
CFTR	R553X and delta F508	doi:10.1038/gim.2016.8	Expanded carrier screening in an infertile population: how often is clinical decision making affected?
CFTR	delta F508 in both	doi:10.1038/gim.2016.8	Expanded carrier screening in an infertile population: how often is clinical decision making affected?
CFTR	c3909C>G and delta F508	doi:10.1038/gim.2016.8	Expanded carrier screening in an infertile population: how often is clinical decision making affected?
CFTR	p.W1282X, delta F508, G542X,c.3842+10kbC>T, p.N1303K, p.D1152H, c.3717+1219C>T	doi:10.1038/gim.2016.30	Carrier screening in the era of expanding genetic technology
CFTR	NM_000492: c.1521_1523del, p.(Phe508del)	doi:10.1038/gim.2016.153	A comprehensive strategy for exome-based preconception carrier screening
CFTR	NM_000492.3: c.2991G>C, p.(Leu997Phe)	doi:10.1038/gim.2016.153	A comprehensive strategy for exome-based preconception carrier screening
CFTR	p.F508del, Ex24:p.F508del (Pathogenic); Ex11:c.1523T>G / p.F508C (Benign); Ex23:c.3870A>G / p.(=) (Benign); 5’ UTR:c.-8G>C (Benign); IVS6:c.743 + 40A>G (Benign)	doi:10.1038/gim.2015.30	Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology
CFTR	CFTR 13: deltaF508, G542X, N1303K, W1282X, 3849+10kbC>T, S549R, G85E, 405+1G>A, I1234V, W1089X, 1717G>A, 3121-1G>A, Y1092X; CFTR 13+ [del8.6Kb, 1717G>A, 2751+1insT, 3121-1G>A, Y1092X, I1234V] and according to the place of origin either 1677delTA or G1244E or C225X or E92X	doi:10.1038/gim.2015.55	The Israeli national population program of genetic carrier screening for reproductive purposes
-	p.Phe508del	doi:10.1038/gim.2014.194	Small-scale high-throughput sequencing–based identification of new therapeutic tools in cystic fibrosis
-	p.Gly542*	doi:10.1038/gim.2014.194	Small-scale high-throughput sequencing–based identification of new therapeutic tools in cystic fibrosis
-	p.Ser776*	doi:10.1038/gim.2014.194	Small-scale high-throughput sequencing–based identification of new therapeutic tools in cystic fibrosis
-	c.2810dup	doi:10.1038/gim.2014.194	Small-scale high-throughput sequencing–based identification of new therapeutic tools in cystic fibrosis
-	p.Trp1282*	doi:10.1038/gim.2014.194	Small-scale high-throughput sequencing–based identification of new therapeutic tools in cystic fibrosis
-	p.Gly85Glu	doi:10.1038/gim.2014.194	Small-scale high-throughput sequencing–based identification of new therapeutic tools in cystic fibrosis
-	c.1116+1G>A	doi:10.1038/gim.2014.194	Small-scale high-throughput sequencing–based identification of new therapeutic tools in cystic fibrosis
-	p.Gln1313*	doi:10.1038/gim.2014.194	Small-scale high-throughput sequencing–based identification of new therapeutic tools in cystic fibrosis
CFTR	c.2052dupA	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population
CFTR	p.W1282X	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population
CFTR	p.W1282X12	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population
CFTR	p.508delF	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population
CFTR	p.G542X	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population
CFTR	p.N1303K	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population
CFTR	c.3717+ 12191C>T	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population
CFTR	p.W1089X	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population
CFTR	p.D1152H	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population
CFTR	c.273+1G>A	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population
CFTR	p.R1066H	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population
CFTR	c.2052dupA*	doi:10.1038/gim.2015.123	Expanded genetic screening panel for the Ashkenazi Jewish population

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:440)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs113857788	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117664780	G	C,T
rs113993958	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530953	G	C,T
rs113993959	7681035	1080	CFTR	umls:C0010674	BeFree	Two adult sisters affected by cystic fibrosis were both shown to carry two different alterations within exon 11 of the CFTR gene, the nonsense mutation G542X and the missense mutation G551D.	0.8	1993	CFTR	7	117587778	G	T
rs113993959	11883825	1080	CFTR	umls:C0010674	BeFree	The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E.	0.8	2002	CFTR	7	117587778	G	T
rs113993959	14586256	1080	CFTR	umls:C0010674	BeFree	We report the case of a patient suffering from idiopathic chronic pancreatitis (ICP) and compound heterozygous for mutations G542X and S1235R of the cystic fibrosis transmembrane regulator (CFTR) gene.	0.8	2003	CFTR	7	117587778	G	T
rs113993959	19136563	1080	CFTR	umls:C0010674	BeFree	Poly-L-aspartic acid enhances and prolongs gentamicin-mediated suppression of the CFTR-G542X mutation in a cystic fibrosis mouse model.	0.8	2009	CFTR	7	117587778	G	T
rs113993959	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587778	G	T
rs113993959	18272502	1080	CFTR	umls:C0010674	BeFree	Using a mouse model for cystic fibrosis (CF), we show that s.c. injection or oral administration of PTC124 to Cftr-/- mice expressing a human CFTR-G542X transgene suppressed the G542X nonsense mutation and restored a significant amount of human (h)CFTR protein and function.	0.8	2008	CFTR	7	117587778	G	T
rs113993960	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559592	CTT	-
rs115545701	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509089	C	T
rs115545701	NA	1080	CFTR	umls:C0010674	UNIPROT	NA	0.8	NA	CFTR	7	117509089	C	T
rs11645366	21602797	1006	CDH8	umls:C0010674	GAD	[Genome-wide association and linkage identify modifier loci of lung disease severity in cystic fibrosis at 11p13 and 20q13.2.]	0.002367032	2011	NA	16	62343249	C	T
rs11971167	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642528	G	A,T
rs11971167	NA	1080	CFTR	umls:C0010674	UNIPROT	NA	0.8	NA	CFTR	7	117642528	G	A,T
rs121908744	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540178	T	-
rs121908745	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559590	ATC	-
rs121908746	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592219	A	-
rs121908747	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627581	C	-
rs121908748	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117590440	G	A,C,T
rs121908749	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509092	C	T
rs121908750	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509140	G	A
rs121908751	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530899	G	A,T
rs121908751	7512993	1080	CFTR	umls:C0010674	BeFree	A novel exon in the cystic fibrosis transmembrane conductance regulator gene activated by the nonsense mutation E92X in airway epithelial cells of patients with cystic fibrosis.	0.8	1994	CFTR	7	117530899	G	A,T
rs121908752	8522333	1080	CFTR	umls:C0010674	BeFree	We report molecular and clinical analyses in four unrelated patients with cystic fibrosis (CF) with compound heterozygosity for the L206W mutation in the cystic fibrosis transmembrane conductance regulator gene (CFTR).	0.8	1995	CFTR	7	117535285	T	G
rs121908752	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117535285	T	G
rs121908753	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540285	G	A
rs121908754	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559643	C	A
rs121908755	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587800	G	A,T
rs121908757	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587799	A	C
rs121908757	10401194	1080	CFTR	umls:C0010674	BeFree	Radiological analysis of children with cystic fibrosis who are homozygous for cystic fibrosis transmembrane conductance regulator mutation S549R (T-->G).	0.8	1999	CFTR	7	117587799	A	C
rs121908757	10764788	1080	CFTR	umls:C0010674	BeFree	Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa.	0.8	2000	CFTR	7	117587799	A	C
rs121908758	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117590394	C	A
rs121908758	10764788	1080	CFTR	umls:C0010674	BeFree	Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa.	0.8	2000	CFTR	7	117590394	C	A
rs121908759	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592032	G	A
rs121908759	25443471	1080	CFTR	umls:C0010674	BeFree	In order to determine whether p.Gly622Asp affects the risk of developing a CFTR-Related disorder (CFTR-RD) or cystic fibrosis (CF), we analyzed the phenotype of subjects bearing the p.Gly622Asp mutation.	0.8	2014	CFTR	7	117592032	G	A
rs121908760	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592292	C	T
rs121908761	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611717	C	A,G
rs121908763	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627640	C	G
rs121908764	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627664	G	A
rs121908765	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627665	G	A
rs121908766	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627765	C	A,T
rs121908767	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117610597	ATAGTG	-
rs121908768	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540163	CTT	-
rs121908769	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509131	TT	-
rs121908770	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117531067	A	-
rs121908771	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117534317	T	-
rs121908772	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117536607	A	-
rs121908773	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117536609	AT	-
rs121908774	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540259	C	-
rs121908775	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559548	CA	-
rs121908776	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559616	TA	-
rs121908777	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117591984	AAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC	-
rs121908778	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592078	G	-
rs121908779	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592090	CTCAAAACT	A
rs121908780	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592140	GAAATTCAATCCT	AGAAA
rs121908781	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117610569	C	-
rs121908783	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627744	T	-
rs121908784	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642464	A	-
rs121908785	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117542052	-	AT
rs121908786	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592219	-	A
rs121908787	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592342	-	A
rs121908788	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603611	-	G
rs121908789	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642493	-	A,T
rs121908791	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509143	G	A
rs121908792	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530898	G	A,C,T
rs121908793	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117535247	G	T
rs121908794	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117590352	G	A
rs121908796	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117590444	G	A,T
rs121908797	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117606753	G	A
rs121908798	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530950	TAT	G
rs121908799	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	NA	7	117592218	AA	-,G
rs121908801	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530938	A	-
rs121908802	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117535263	C	T
rs121908803	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117535281	C	T
rs121908804	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117535388	AGGGAGAATGATGATGAAGTAC	-
rs121908805	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559468	C	A,G,T
rs121908808	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117652852	-	T
rs121908810	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592457	C	T
rs121908811	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627712	C	-
rs121908812	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592179	T	-
rs121909005	10401194	1080	CFTR	umls:C0010674	BeFree	Radiological analysis of children with cystic fibrosis who are homozygous for cystic fibrosis transmembrane conductance regulator mutation S549R (T-->G).	0.8	1999	CFTR	7	117587801	T	G
rs121909005	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587801	T	G
rs121909005	10764788	1080	CFTR	umls:C0010674	BeFree	Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa.	0.8	2000	CFTR	7	117587801	T	G
rs121909006	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117590360	T	A,G
rs121909006	10764788	1080	CFTR	umls:C0010674	BeFree	Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa.	0.8	2000	CFTR	7	117590360	T	A,G
rs121909008	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603612	A	G
rs121909009	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117548804	G	T
rs121909010	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117652915	G	A
rs121909010	1721624	1080	CFTR	umls:C0010674	BeFree	Severe deficiency of cystic fibrosis transmembrane conductance regulator messenger RNA carrying nonsense mutations R553X and W1316X in respiratory epithelial cells of patients with cystic fibrosis.	0.8	1991	CFTR	7	117652915	G	A
rs121909011	11883825	1080	CFTR	umls:C0010674	BeFree	The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E.	0.8	2002	CFTR	7	117540230	C	T
rs121909011	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540230	C	T
rs121909011	NA	1080	CFTR	umls:C0010674	UNIPROT	NA	0.8	NA	CFTR	7	117540230	C	T
rs121909011	9039981	1080	CFTR	umls:C0010674	BeFree	We present a phenotype-genotype correlation analysis in 12 patients with cystic fibrosis (CF) carrying the mutation R334W in the CFTR gene.	0.8	1997	CFTR	7	117540230	C	T
rs121909012	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117594990	C	T
rs121909013	7544788	1080	CFTR	umls:C0010674	BeFree	Because PPi stimulated wild-type channels, we tested its effect on CFTR containing the cystic fibrosis mutations: delta F508, R117H, and G551S.	0.8	1995	CFTR	7	117587805	G	A
rs121909013	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587805	G	A
rs121909015	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642593	G	C
rs121909016	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540163	C	G
rs121909017	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559546	C	T
rs121909018	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592646	G	T
rs121909019	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611638	G	A,T
rs121909020	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611640	G	A,C
rs121909021	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540276	C	T
rs121909023	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592313	A	T
rs121909025	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509040	G	A
rs121909026	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117652905	C	A,T
rs121909028	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642577	T	C
rs121909031	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530951	A	G
rs121909033	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592110	A	T
rs121909034	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603609	C	A,T
rs121909035	8910333	1080	CFTR	umls:C0010674	BeFree	To examine the contribution of the large cytoplasmic loops of the cystic fibrosis transmembrane conductance regulator (CFTR) to channel activity, the three point-mutations (S945L, H949Y, G970R) were characterized that have been detected in the third cytoplasmic loop (CL3, residues 933-990) in patients with cystic fibrosis.	0.8	1996	CFTR	7	117603719	C	T
rs121909035	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603719	C	T
rs121909036	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611635	T	C,G
rs121909037	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611653	A	C
rs121909040	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642466	G	A
rs121909041	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642483	T	C
rs121909042	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117652875	A	C
rs121909043	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117667029	C	G
rs121909044	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587812	G	A
rs121909044	19176844	1080	CFTR	umls:C0010674	BeFree	Transient correction of the basic defect in sweat glands in an individual with cystic fibrosis carrying the complex CFTR allele F508del-R553Q.	0.8	2009	CFTR	7	117587812	G	A
rs121909045	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117480113	G	C,T
rs121909046	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117535318	A	G
rs121909047	14623323	1080	CFTR	umls:C0010674	BeFree	A561E, a novel cystic fibrosis (CF) associated mutation in the first nucleotide binding domain of CFTR, is the second most common CF mutation in Portugal.	0.8	2003	CFTR	7	117590355	C	A
rs121909047	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117590355	C	A
rs12883884	21602797	6547	SLC8A3	umls:C0010674	GAD	[Genome-wide association and linkage identify modifier loci of lung disease severity in cystic fibrosis at 11p13 and 20q13.2.]	0.002367032	2011	SLC8A3	14	70050466	T	G
rs139304906	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611671	T	C
rs139468767	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592020	T	C
rs139573311	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559471	T	C
rs139729994	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117614713	G	A,T
rs1403543	21602797	186	AGTR2	umls:C0010674	GAD	[Genome-wide association and linkage identify modifier loci of lung disease severity in cystic fibrosis at 11p13 and 20q13.2.]	0.002367032	2011	AGTR2	X	116170939	G	A
rs141033578	23361109	1080	CFTR	umls:C0010674	BeFree	Impaired CFTR function in mild cystic fibrosis associated with the S977F/T5TG12complex allele in trans with F508del mutation.	0.8	2012	CFTR	7	117606695	C	T
rs141158996	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592658	G	A,T
rs142394380	7683628	1080	CFTR	umls:C0010674	UNIPROT	Identification of eight novel mutations in a collaborative analysis of a part of the second transmembrane domain of the CFTR gene.	0.8	1993	CFTR	7	117611622	G	C
rs142394380	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611622	G	C
rs142864834	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117536650	A	T
rs143570767	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642594	G	A
rs144055758	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117610625	A	G
rs144745159	21152102	1080	CFTR	umls:C0010674	BeFree	The co-translational rescue of ΔF508 NBD1 misfolding in CFTR by I539T advocates this domain as the most important drug target for cystic fibrosis.	0.8	2010	CFTR	7	117587770	T	C
rs145449046	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592541	C	G,T
rs147422190	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117548758	G	T
rs149790377	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603613	T	A
rs150157202	NA	1080	CFTR	umls:C0010674	UNIPROT	NA	0.8	NA	CFTR	7	117592427	G	A
rs150212784	11883825	1080	CFTR	umls:C0010674	BeFree	The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E.	0.8	2002	CFTR	7	117611595	T	G
rs150212784	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611595	T	G
rs150691494	NA	1080	CFTR	umls:C0010674	UNIPROT	NA	0.8	NA	CFTR	7	117540132	A	G
rs151020603	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117504336	C	A,T
rs17140229	23614351	2015	EMR1	umls:C0010674	BeFree	Repetitive MAS were strongly associated with EMR1-rs373533 in Kumasi (p = 0.00003) and cystic fibrosis transmembrane conductance receptor-rs17140229 in the pooled analysis (p = 0.00543).	0.000271442	2013	CFTR	7	117590229	T	C
rs1800076	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509093	G	A,T
rs1800092	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559589	C	A,G
rs1800097	8956039	1080	CFTR	umls:C0010674	UNIPROT	In total, 30 CFTR mutations account for 93.9% of the 412 Northern Irish CF chromosomes tested.	0.8	1996	CFTR	7	117590357	G	A,C
rs1800098	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117590400	G	C,T
rs1800111	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117610521	G	C
rs1800111	NA	1080	CFTR	umls:C0010674	UNIPROT	NA	0.8	NA	CFTR	7	117610521	G	C
rs1800111	17681820	6690	SPINK1	umls:C0010674	BeFree	Remarkably, in all three affected individuals, the SPINK1 deletion was found to be co-inherited with a heterozygous p.L997F missense mutation in the unlinked CFTR gene, a lesion previously reported to be associated with a variety of cystic fibrosis-related diseases including idiopathic pancreatitis.	0.010258709	2007	CFTR	7	117610521	G	C
rs1800111	20706124	1080	CFTR	umls:C0010674	BeFree	To evaluate the role of complex alleles, with two or more mutations in cis position, of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in the definition of the genotype-phenotype relationship in cystic fibrosis (CF), and to evaluate the functional significance of the highly controversial L997F CFTR mutation.	0.8	2010	CFTR	7	117610521	G	C
rs1800111	17681820	1080	CFTR	umls:C0010674	BeFree	Remarkably, in all three affected individuals, the SPINK1 deletion was found to be co-inherited with a heterozygous p.L997F missense mutation in the unlinked CFTR gene, a lesion previously reported to be associated with a variety of cystic fibrosis-related diseases including idiopathic pancreatitis.	0.8	2007	CFTR	7	117610521	G	C
rs1800123	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627712	C	T
rs1800470	NA	7040	TGFB1	umls:C0010674	CLINVAR	NA	0.39110499	NA	TGFB1	19	41353016	G	C,A
rs186045772	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611663	T	A
rs193922498	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117504313	C	G
rs193922500	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117548798	T	C
rs193922501	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117480108	C	T
rs193922503	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587731	G	A,T
rs193922504	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587827	T	C
rs193922505	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117590365	A	-
rs193922509	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603642	C	A
rs193922510	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603684	-	T
rs193922511	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603687	T	G
rs193922514	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117606697	A	T
rs193922515	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117610517	A	G,T
rs193922516	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117610568	C	A,G,T
rs193922518	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530980	A	G
rs193922519	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530995	G	C
rs193922520	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627775	G	A
rs193922521	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117531007	-	TAT
rs193922523	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117652925	-	AGGG
rs193922524	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117664721	G	T
rs193922525	15163550	1080	CFTR	umls:C0010674	BeFree	The cystic fibrosis mutation G1349D within the signature motif LSHGH of NBD2 abolishes the activation of CFTR chloride channels by genistein.	0.8	2004	CFTR	7	117664770	G	A
rs193922525	16311240	1080	CFTR	umls:C0010674	BeFree	Differential sensitivity of the cystic fibrosis (CF)-associated mutants G551D and G1349D to potentiators of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel.	0.8	2006	CFTR	7	117664770	G	A
rs193922525	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117664770	G	A
rs193922526	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117665566	T	C
rs193922528	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117666945	T	C
rs193922529	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117535260	G	A,C
rs193922532	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117536629	C	G
rs193922533	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540227	C	T
rs200337193	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509031	C	A,T
rs201124247	NA	1080	CFTR	umls:C0010674	UNIPROT	NA	0.8	NA	CFTR	7	117592008	A	G
rs201958172	11883825	1080	CFTR	umls:C0010674	BeFree	The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E.	0.8	2002	CFTR	7	117530983	G	A,T
rs201978662	NA	1080	CFTR	umls:C0010674	UNIPROT	NA	0.8	NA	CFTR	7	117592004	G	A
rs2231142	23800412	1080	CFTR	umls:C0010674	BeFree	In the present work we examined the stability and cellular processing of the Q141K ABCG2 variant, as well as that of the ΔF142 ABCG2, corresponding to the ΔF508 mutation in the CFTR (ABCC7) protein, causing cystic fibrosis.	0.8	2013	ABCG2	4	88131171	G	T
rs2231142	23800412	9429	ABCG2	umls:C0010674	BeFree	In the present work we examined the stability and cellular processing of the Q141K ABCG2 variant, as well as that of the ΔF142 ABCG2, corresponding to the ΔF508 mutation in the CFTR (ABCC7) protein, causing cystic fibrosis.	0.001628651	2013	ABCG2	4	88131171	G	T
rs267606722	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117594977	G	A
rs267606723	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642451	G	A,T
rs2734705	20179644	9629	CLCA3P	umls:C0010674	BeFree	The aim of the study was to investigate whether the p.S357N variant in CLCA1, the human orthologue of Clca3, acts as a modifier gene in a cohort of 682 European patients with cystic fibrosis (CF)-99 patients with meconium ileus.	0.000271442	2010	CLCA1	1	86486641	A	G
rs2734705	20179644	1179	CLCA1	umls:C0010674	BeFree	Association of the CLCA1 p.S357N variant with meconium ileus in European patients with cystic fibrosis.	0.00617715	2010	CLCA1	1	86486641	A	G
rs34911792	NA	1080	CFTR	umls:C0010674	UNIPROT	NA	0.8	NA	CFTR	7	117627758	T	G
rs34911792	14586256	1080	CFTR	umls:C0010674	BeFree	We report the case of a patient suffering from idiopathic chronic pancreatitis (ICP) and compound heterozygous for mutations G542X and S1235R of the cystic fibrosis transmembrane regulator (CFTR) gene.	0.8	2003	CFTR	7	117627758	T	G
rs35516286	NA	1080	CFTR	umls:C0010674	UNIPROT	NA	0.8	NA	CFTR	7	117531068	T	A,C
rs35516286	15371908	1080	CFTR	umls:C0010674	BeFree	We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T.	0.8	2004	CFTR	7	117531068	T	A,C
rs35516286	12394343	1080	CFTR	umls:C0010674	BeFree	The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis.	0.8	2002	CFTR	7	117531068	T	A,C
rs36210737	7680525	1080	CFTR	umls:C0010674	UNIPROT	Identification of the M1101K mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and complete detection of cystic fibrosis mutations in the Hutterite population.	0.8	1993	CFTR	7	117611743	T	A,G
rs36210737	7680525	1080	CFTR	umls:C0010674	BeFree	Identification of the M1101K mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and complete detection of cystic fibrosis mutations in the Hutterite population.	0.8	1993	CFTR	7	117611743	T	A,G
rs36210737	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611743	T	A,G
rs368505753	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509069	C	T
rs372227120	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117665565	G	A,T
rs373002889	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627502	T	C
rs373533	23614351	2015	EMR1	umls:C0010674	BeFree	Repetitive MAS were strongly associated with EMR1-rs373533 in Kumasi (p = 0.00003) and cystic fibrosis transmembrane conductance receptor-rs17140229 in the pooled analysis (p = 0.00543).	0.000271442	2013	EMR1;LOC105372256	19	6919613	A	C
rs374705585	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117667091	C	T
rs374946172	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592520	C	T
rs386134230	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117606674	G	A
rs386602276	12600951	3356	HTR2A	umls:C0010674	BeFree	Polymorphisms in the HTR2A (T102C), beta-globin [hemoglobin (Hb) S, C, and E], and cystic fibrosis (F508del, F508C, I507del, I506V) genes were analyzed.	0.000271442	2003	NA	NA	NA	NA	NA
rs387906359	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592589	-	AT
rs387906360	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540252	-	TC
rs387906361	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540311	T	-
rs387906362	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627774	A	G
rs387906363	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117531049	A	-
rs387906364	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117531054	T	-
rs387906365	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540323	CT	-
rs387906366	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611629	-	CTATG
rs387906367	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117536534	TGATTGATTTAC	-
rs387906368	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587755	C	A
rs387906369	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642437	G	A
rs387906370	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642487	-	C,T
rs387906371	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117531084	AATAGCTATGTTTAGTTT	-
rs387906373	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117652846	TATT	-
rs387906374	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509146	A	G
rs387906375	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540313	G	-
rs387906376	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592458	G	-
rs387906377	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611602	A	-
rs387906378	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627588	-	TCAA
rs387906379	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627545	-	T
rs387906380	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117536664	-	A
rs397508136	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117480086	CGAGAGACCATGCAGAGGTCGCC	-
rs397508138	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540236	-	G
rs397508139	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540237	T	A,C
rs397508144	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540251	T	C
rs397508158	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540347	G	A,C
rs397508163	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117542026	-	A
rs397508168	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117504314	C	T
rs397508173	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117480105	C	A,T
rs397508174	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117542101	G	A,T
rs397508175	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117542102	G	A,C
rs397508176	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117542109	G	A
rs397508183	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117548671	C	T
rs397508188	20052366	1080	CFTR	umls:C0010674	BeFree	The L441P mutation of cystic fibrosis transmembrane conductance regulator and its molecular pathogenic mechanisms in a Korean patient with cystic fibrosis.	0.8	2010	CFTR	7	117548753	T	C
rs397508189	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117548760	-	AGAT
rs397508192	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117548771	A	-
rs397508200	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559463	G	A
rs397508201	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559462	A	G
rs397508205	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559489	G	-
rs397508211	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559537	C	A,T
rs397508211	22627569	1080	CFTR	umls:C0010674	BeFree	This study reports on the phenotype of cystic fibrosis patients identified to be carriers of the p.Ser489X (p.Ser489*; c.1466C>A) cystic fibrosis transmembrane conductance regulator (CFTR) mutation, a variant rarely described in the cystic fibrosis literature, as well as on its allelic frequency in a French-Canadian cystic fibrosis patient cohort.	0.8	2012	CFTR	7	117559537	C	A,T
rs397508227	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559644	C	T
rs397508243	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117504364	G	A,C,T
rs397508247	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587802	G	A,T
rs397508249	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509033	G	A
rs397508251	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587804	A	-
rs397508256	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509035	G	A
rs397508263	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587834	G	C
rs397508276	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117590378	T	C,G
rs397508276	9482579	1080	CFTR	umls:C0010674	BeFree	Detection of five novel mutations of the cystic fibrosis transmembrane regulator (CFTR) gene in Pakistani patients with cystic fibrosis: Y569D, Q98X, 296+12(T>C), 1161delC and 621+2(T>C).	0.8	1998	CFTR	7	117590378	T	C,G
rs397508279	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509039	G	A
rs397508294	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509043	-	A
rs397508296	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117590426	G	T
rs397508298	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117590442	A	C,G
rs397508303	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117591959	AAAACTA	-
rs397508310	19457724	1080	CFTR	umls:C0010674	BeFree	CFTR H609R mutation in Ecuadorian patients with cystic fibrosis.	0.8	2009	CFTR	7	117591993	A	G,T
rs397508325	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592151	CTAA	-
rs397508328	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117480095	A	G
rs397508331	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592184	G	T
rs397508333	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592203	G	A
rs397508336	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592220	C	T
rs397508350	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592362	T	G
rs397508353	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592382	G	-
rs397508360	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509096	-	T
rs397508378	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592631	G	A,T
rs397508387	20949073	1080	CFTR	umls:C0010674	BeFree	We identified such a mechanism as the origin of the mild to asymptomatic phenotype observed in cystic fibrosis patients homozygous for the E831X mutation (2623G>T) in the CFTR gene.	0.8	2010	CFTR	7	117594930	G	T
rs397508387	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117594930	G	T
rs397508393	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117594976	G	A
rs397508394	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117594986	C	A
rs397508399	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117595022	T	-
rs397508400	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117595028	AATTTGGTGCT	-
rs397508405	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117595039	-	A
rs397508414	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117602865	-	A
rs397508416	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603531	G	T
rs397508431	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603638	-	AG
rs397508435	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603654	T	C
rs397508441	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603699	T	-
rs397508442	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603708	C	T
rs397508442	8910333	1080	CFTR	umls:C0010674	BeFree	To examine the contribution of the large cytoplasmic loops of the cystic fibrosis transmembrane conductance regulator (CFTR) to channel activity, the three point-mutations (S945L, H949Y, G970R) were characterized that have been detected in the third cytoplasmic loop (CL3, residues 933-990) in patients with cystic fibrosis.	0.8	1996	CFTR	7	117603708	C	T
rs397508445	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603733	ACATTCTGTTCTTCAAGCACCTATGTCAACCC	-
rs397508447	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603749	G	-
rs397508451	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603770	A	-
rs397508453	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603782	G	A,C
rs397508453	8910333	1080	CFTR	umls:C0010674	BeFree	To examine the contribution of the large cytoplasmic loops of the cystic fibrosis transmembrane conductance regulator (CFTR) to channel activity, the three point-mutations (S945L, H949Y, G970R) were characterized that have been detected in the third cytoplasmic loop (CL3, residues 933-990) in patients with cystic fibrosis.	0.8	1996	CFTR	7	117603782	G	A,C
rs397508461	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530917	C	T
rs397508461	9482579	1080	CFTR	umls:C0010674	BeFree	Detection of five novel mutations of the cystic fibrosis transmembrane regulator (CFTR) gene in Pakistani patients with cystic fibrosis: Y569D, Q98X, 296+12(T>C), 1161delC and 621+2(T>C).	0.8	1998	CFTR	7	117530917	C	T
rs397508462	9401110	1080	CFTR	umls:C0010674	BeFree	CFTR gene analysis in cystic fibrosis patients: detection of 91% of molecular defects and identification of the novel mutation D979V.	0.8	1997	CFTR	7	117606701	A	C,T
rs397508470	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117610518	G	A
rs397508476	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117480096	T	A,C
rs397508477	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117610532	TG	-
rs397508482	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117610552	G	-
rs397508499	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530935	A	-
rs397508505	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117610669	GG	-
rs397508510	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611601	C	G
rs397508532	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611734	G	A
rs397508533	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611735	G	C
rs397508536	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611745	A	T
rs397508537	11883825	1080	CFTR	umls:C0010674	BeFree	The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E.	0.8	2002	CFTR	7	117530955	C	A
rs397508538	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611751	G	T
rs397508587	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627658	A	-
rs397508596	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642435	T	C,G
rs397508604	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642481	T	G
rs397508630	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117652851	A	-
rs397508637	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117652876	A	-
rs397508668	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117664801	TGTT	AA
rs397508669	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117664810	-	T
rs397508672	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117531034	C	-
rs397508675	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117664835	G	T
rs397508684	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117665466	C	A,T
rs397508685	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117665469	-	A
rs397508693	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117665518	TC	-
rs397508701	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117665553	C	T
rs397508702	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117665556	C	T
rs397508706	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117666916	A	-
rs397508709	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117666961	-	GA
rs397508739	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117480144	-	TT
rs397508742	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117480144	T	-
rs397508746	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117480148	G	T
rs397508750	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117534329	TAGT	-
rs397508759	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117534363	G	A,T
rs397508761	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117534368	A	C,G,T
rs397508778	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117535326	C	T
rs397508782	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117535348	T	G
rs397508783	24412276	1080	CFTR	umls:C0010674	BeFree	The cystic fibrosis V232D mutation inhibits CFTR maturation by disrupting a hydrophobic pocket rather than formation of aberrant interhelical hydrogen bonds.	0.8	2013	CFTR	7	117535363	T	A
rs397508791	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117535412	G	A,C
rs397508796	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117504278	G	A,C,T
rs397508799	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117536632	C	A
rs397508805	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117536663	AACTT	-
rs397508824	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540217	A	-
rs397515498	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592620	T	-
rs4986790	16830219	7099	TLR4	umls:C0010674	BeFree	Modifier effect of the Toll-like receptor 4 D299G polymorphism in children with cystic fibrosis.	0.003995683	2006	TLR4	9	117713024	A	G
rs556880586	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117542016	G	A
rs61738523	17681820	1080	CFTR	umls:C0010674	BeFree	Remarkably, in all three affected individuals, the SPINK1 deletion was found to be co-inherited with a heterozygous p.L997F missense mutation in the unlinked CFTR gene, a lesion previously reported to be associated with a variety of cystic fibrosis-related diseases including idiopathic pancreatitis.	0.8	2007	CFTR	7	117603539	C	T
rs61738523	20706124	1080	CFTR	umls:C0010674	BeFree	To evaluate the role of complex alleles, with two or more mutations in cis position, of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in the definition of the genotype-phenotype relationship in cystic fibrosis (CF), and to evaluate the functional significance of the highly controversial L997F CFTR mutation.	0.8	2010	CFTR	7	117603539	C	T
rs61738523	17681820	6690	SPINK1	umls:C0010674	BeFree	Remarkably, in all three affected individuals, the SPINK1 deletion was found to be co-inherited with a heterozygous p.L997F missense mutation in the unlinked CFTR gene, a lesion previously reported to be associated with a variety of cystic fibrosis-related diseases including idiopathic pancreatitis.	0.010258709	2007	CFTR	7	117603539	C	T
rs61750120	26092729	9429	ABCG2	umls:C0010674	BeFree	Here, we have examined two disease-causing mutations in the NBD1 region of ABCA4, R1108C, and R1129C, which occur within regions of high similarity with CFTR, another ABC transporter gene, which is associated with cystic fibrosis.	0.001628651	2015	ABCA4	1	94042767	G	A
rs61750120	26092729	1080	CFTR	umls:C0010674	BeFree	Here, we have examined two disease-causing mutations in the NBD1 region of ABCA4, R1108C, and R1129C, which occur within regions of high similarity with CFTR, another ABC transporter gene, which is associated with cystic fibrosis.	0.8	2015	ABCA4	1	94042767	G	A
rs6313	12600951	3356	HTR2A	umls:C0010674	BeFree	Polymorphisms in the HTR2A (T102C), beta-globin [hemoglobin (Hb) S, C, and E], and cystic fibrosis (F508del, F508C, I507del, I506V) genes were analyzed.	0.000271442	2003	HTR2A	13	46895805	G	A
rs672601314	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117652932	G	A
rs672601315	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603574	T	A
rs672601316	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592610	G	T
rs672601317	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117536634	G	A
rs727504486	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117548634	TT	-
rs73715573	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117548630	T	G
rs74467662	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509145	A	C,G
rs74503330	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642472	G	A
rs74551128	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117548795	C	T,A
rs74571530	19092444	1080	CFTR	umls:C0010674	BeFree	The objective of this study was to determine whether the F508C variant in the cystic fibrosis transmembrane conductance regulator gene has a significant effect on congenital bilateral absence of the vas deferens prevalence, when present in conjunction with a second cystic fibrosis transmembrane conductance regulator disease causing mutation.	0.8	2008	CFTR	7	117559594	T	C,G
rs74597325	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587811	C	G,T
rs74597325	7514569	1080	CFTR	umls:C0010674	BeFree	We have studied the effects of the stop mutation R553X in exon 11 of the CFTR gene by analyzing mRNA extracted from nasal epithelial cells harvested from patients with cystic fibrosis.	0.8	1994	CFTR	7	117587811	C	G,T
rs74597325	1721624	1080	CFTR	umls:C0010674	BeFree	Severe deficiency of cystic fibrosis transmembrane conductance regulator messenger RNA carrying nonsense mutations R553X and W1316X in respiratory epithelial cells of patients with cystic fibrosis.	0.8	1991	CFTR	7	117587811	C	G,T
rs74767530	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627537	C	T
rs75039782	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117639961	C	G,T
rs75053309	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540309	C	A,G,T
rs75096551	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117606754	G	A
rs75115087	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592295	A	T
rs75389940	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627753	A	C,G,T
rs75527207	23590265	1080	CFTR	umls:C0010674	BeFree	This randomized, double-blind, placebo-controlled trial evaluated ivacaftor in patients with cystic fibrosis aged 6-11 years with a G551D-CFTR mutation on at least one allele.	0.8	2013	CFTR	7	117587806	G	A
rs75527207	25148434	1080	CFTR	umls:C0010674	BeFree	The G551D cystic fibrosis transmembrane conductance regulator (CFTR) mutation is associated with severe disease in ∼5% of cystic fibrosis patients worldwide.	0.8	2014	CFTR	7	117587806	G	A
rs75527207	24927234	1080	CFTR	umls:C0010674	BeFree	Clinical mechanism of the cystic fibrosis transmembrane conductance regulator potentiator ivacaftor in G551D-mediated cystic fibrosis.	0.8	2014	CFTR	7	117587806	G	A
rs75527207	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587806	G	A
rs75527207	18167357	1080	CFTR	umls:C0010674	BeFree	Mechanism of G551D-CFTR (cystic fibrosis transmembrane conductance regulator) potentiation by a high affinity ATP analog.	0.8	2008	CFTR	7	117587806	G	A
rs75527207	25311995	1080	CFTR	umls:C0010674	BeFree	Ivacaftor, a cystic fibrosis transmembrane conductance regulator (CFTR) potentiator, is approved for the treatment of patients with cystic fibrosis aged 6 years or older with Gly551Asp-CFTR.	0.8	2015	CFTR	7	117587806	G	A
rs75527207	7681035	1080	CFTR	umls:C0010674	BeFree	Two adult sisters affected by cystic fibrosis were both shown to carry two different alterations within exon 11 of the CFTR gene, the nonsense mutation G542X and the missense mutation G551D.	0.8	1993	CFTR	7	117587806	G	A
rs75527207	23757359	1080	CFTR	umls:C0010674	BeFree	Recently, ivacaftor, a CFTR-potentiator, has been shown to be effective and safe in patients with cystic fibrosis carrying a G551D mutation and moderately impaired lung function.	0.8	2013	CFTR	7	117587806	G	A
rs75527207	22047557	1080	CFTR	umls:C0010674	BeFree	A CFTR potentiator in patients with cystic fibrosis and the G551D mutation.	0.8	2011	CFTR	7	117587806	G	A
rs75527207	16311240	1080	CFTR	umls:C0010674	BeFree	Differential sensitivity of the cystic fibrosis (CF)-associated mutants G551D and G1349D to potentiators of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel.	0.8	2006	CFTR	7	117587806	G	A
rs75527207	21083385	1080	CFTR	umls:C0010674	BeFree	Effect of VX-770 in persons with cystic fibrosis and the G551D-CFTR mutation.	0.8	2010	CFTR	7	117587806	G	A
rs755416052	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117614611	A	G,T
rs75541969	11883825	1080	CFTR	umls:C0010674	BeFree	The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E.	0.8	2002	CFTR	7	117614699	G	C
rs75541969	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117614699	G	C
rs75541969	19843100	1080	CFTR	umls:C0010674	BeFree	Non-classic cystic fibrosis associated with D1152H CFTR mutation.	0.8	2010	CFTR	7	117614699	G	C
rs75541969	22310382	1080	CFTR	umls:C0010674	BeFree	A large deletion causes apparent homozygosity for the D1152H mutation in the cystic fibrosis transmembrane regulator (CFTR) gene.	0.8	2012	CFTR	7	117614699	G	C
rs75549581	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587829	G	A
rs75789129	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587820	A	G
rs75961395	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509123	G	A,T
rs76151804	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611555	A	G
rs76554633	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587808	C	T
rs76649725	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642484	C	A,T
rs76713772	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587738	G	A
rs76879328	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540305	C	A
rs77010898	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642566	G	A,C
rs77010898	11438995	1080	CFTR	umls:C0010674	BeFree	In the present paper, biospecific interaction analysis (BIA) was performed using surface plasmon resonance (SPR) and biosensor technologies to detect the Trp1282Ter mutation (W1282X) of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene.	0.8	2001	CFTR	7	117642566	G	A,C
rs77101217	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559548	C	T
rs77188391	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117534366	G	T
rs77284892	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117509047	G	T,A
rs77409459	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540243	C	T
rs77646904	1284466	1080	CFTR	umls:C0010674	UNIPROT	Three novel mutations in the cystic fibrosis gene detected by chemical cleavage: analysis of variant splicing and a nonsense mutation.	0.8	1992	CFTR	7	117559629	G	T,C,A
rs77646904	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559629	G	T,C,A
rs77834169	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530974	C	A,G,T
rs77902683	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642568	G	A,T
rs77932196	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540270	G	A,C,T
rs78194216	9375855	1080	CFTR	umls:C0010674	BeFree	Missense mutation R1066C in the second transmembrane domain of CFTR causes a severe cystic fibrosis phenotype: study of 19 heterozygous and 2 homozygous patients.	0.8	1997	CFTR	7	117611637	C	A,T
rs78194216	11883825	1080	CFTR	umls:C0010674	BeFree	The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E.	0.8	2002	CFTR	7	117611637	C	A,T
rs78194216	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611637	C	A,T
rs78440224	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117534370	G	A
rs786204587	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117548761	-	GATA
rs786204693	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117536654	-	A
rs78655421	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530975	G	A,C,T
rs78655421	7544788	1080	CFTR	umls:C0010674	BeFree	Because PPi stimulated wild-type channels, we tested its effect on CFTR containing the cystic fibrosis mutations: delta F508, R117H, and G551S.	0.8	1995	CFTR	7	117530975	G	A,C,T
rs78655421	21507732	1080	CFTR	umls:C0010674	BeFree	However knowledge about the residual function of R117H-CFTR channels in cystic fibrosis-affected organs, e.g.	0.8	2011	CFTR	7	117530975	G	A,C,T
rs78655421	17015492	1080	CFTR	umls:C0010674	BeFree	Immunoreactive trypsin/DNA newborn screening for cystic fibrosis: should the R117H variant be included in CFTR mutation panels?	0.8	2006	CFTR	7	117530975	G	A,C,T
rs78655421	18394117	1080	CFTR	umls:C0010674	BeFree	Debate continues regarding the clinical implications for compound heterozygotes identified with Phe508del and Arg117His-7T mutations of the cystic fibrosis transmembrane regulator (CFTR) gene.	0.8	2008	CFTR	7	117530975	G	A,C,T
rs78655421	23378603	1080	CFTR	umls:C0010674	BeFree	The high frequency of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene mutation p.Arg117His in patients with congenital bilateral absence of the vas deferens (CBAVD) and in newborns screened for CF has created a dilemma.	0.8	2013	CFTR	7	117530975	G	A,C,T
rs78756941	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117531115	G	T
rs78769542	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611650	G	A,C
rs78802634	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611707	G	A
rs78909279	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540320	T	C
rs79031340	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117540218	G	T
rs79282516	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117559509	G	A,T
rs796065332	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117536652	AAATGATTGAAAA	TG
rs79633941	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117603542	C	T
rs79635528	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117611695	A	G
rs79660178	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117530991	T	A
rs797045156	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592629	GT	-
rs797045157	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592591	-	AT
rs797045158	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117652867	-	T
rs797045159	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117642467	G	-
rs797045160	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117542015	G	A
rs797045161	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117548796	GG	-
rs797045162	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117592220	-	C
rs79850223	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117627525	C	A,G,T
rs80034486	20865572	1080	CFTR	umls:C0010674	BeFree	We report a newborn presenting with bilateral pneumothorax whose diagnosis was cystic fibrosis with N1303K mutation on CFTR gene.	0.8	2010	CFTR	7	117652877	C	G
rs80034486	11883825	1080	CFTR	umls:C0010674	BeFree	The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E.	0.8	2002	CFTR	7	117652877	C	G
rs80034486	9401006	1080	CFTR	umls:C0010674	UNIPROT	More than 120 known cystic fibrosis transmembrane conductance regulator (CFTR) disease-causing mutations were screened.	0.8	1997	CFTR	7	117652877	C	G
rs80034486	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117652877	C	G
rs80055610	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117587833	G	A,C
rs80224560	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117602868	G	A
rs80282562	NA	1080	CFTR	umls:C0010674	CLINVAR	NA	0.8	NA	CFTR	7	117534318	G	A

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:18)
CHR	POS	SNPID	REF	ALT	ORI_SNPID	PMID	P_VALUE	P_VALUE_TEXT	OR/BETA	CI95_TEXT	GWAS_INITIAL_SAMPLE_SIZE	SUB_POPULATION	SUPER_POPULATION	GWAS_TRAIT	HPO_ID	HPO_TERM	DO_ID	DO_TERM	MESH_ID	MESH_TERM	EFO_ID	EFO_TERM	DOLITE_TERM	RISK_ALLELE	PUBLICATION_TYPE	AA	GENE_SYMBOL	TYPE	REFGENE
1	205899595	rs7512462	T	C	rs7512462	22466613	2.03E-08	NA	NA	NA	3,763 European ancestry cases	European(3763)	ALL(3763)	EUR(3763)	ALL(3763)	Cystic fibrosis (meconium ileus)	HPOID:0004401	Meconium ileus	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	NA	NA	Cystic fibrosis	NA	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	T
1	205914757	rs4077468	A	G	rs4077468	22466613	9.44E-09	NA	NA	NA	3,763 European ancestry cases	European(3763)	ALL(3763)	EUR(3763)	ALL(3763)	Cystic fibrosis (meconium ileus)	HPOID:0004401	Meconium ileus	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	NA	NA	Cystic fibrosis	NA	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	G
1	205916699	rs12047830	G	A	rs12047830	22466613	3.26E-06	NA	NA	NA	3,763 European ancestry cases	European(3763)	ALL(3763)	EUR(3763)	ALL(3763)	Cystic fibrosis (meconium ileus)	HPOID:0004401	Meconium ileus	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	NA	NA	Cystic fibrosis	NA	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	G
1	205917309	rs7419153	G	A	rs7419153	22466613	1.22E-07	NA	NA	NA	3,763 European ancestry cases	European(3763)	ALL(3763)	EUR(3763)	ALL(3763)	Cystic fibrosis (meconium ileus)	HPOID:0004401	Meconium ileus	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	NA	NA	Cystic fibrosis	NA	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	G
5	428236	rs12188164	C	A	rs12188164	21602797	4.00E-06	NA	NA	NA	up to 2,494 individuals with cystic fibrosis	NOPOP(2494)	ALL(2494)	NOPOP(2494)	ALL(2494)	Cystic fibrosis severity	HPOID:0006552	Fibrocystic lung disease	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	cystic fibrosis	Cystic fibrosis	rs12188164-A	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	A	AHRR
6	32432077	rs9268905	G	C	rs9268905	21602797	1.00E-07	NA	NA	NA	up to 2,494 individuals with cystic fibrosis	NOPOP(2494)	ALL(2494)	NOPOP(2494)	ALL(2494)	Cystic fibrosis severity	HPOID:0006552	Fibrocystic lung disease	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	cystic fibrosis	Cystic fibrosis	rs9268905-C	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	G	NA
7	112092857	rs6966318	T	C	rs6966318	19242412	5.46E-04	Lung disease severity	NA	NA	241 European ancestry severe cases; 538 European ancestry mild cases	European(779)	ALL(779)	EUR(779)	ALL(779)	Cystic fibrosis(lung disease)	HPOID:0006552	Fibrocystic lung disease	DOID:1485	cystic fibrosis	NA	NA	NA	NA	Cystic fibrosis	NA	Twin Study	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't
7	112103055	rs2529588	A	G	rs2529588	19242412	4.00E-06	Lung disease severity	NA	NA	241 European ancestry severe cases; 538 European ancestry mild cases	European(779)	ALL(779)	EUR(779)	ALL(779)	Cystic fibrosis(lung disease)	HPOID:0006552	Fibrocystic lung disease	DOID:1485	cystic fibrosis	NA	NA	NA	NA	Cystic fibrosis	NA	Twin Study	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't
7	112166964	rs1981610	A	G	rs1981610	19242412	2.26E-04	Lung disease severity	NA	NA	241 European ancestry severe cases; 538 European ancestry mild cases	European(779)	ALL(779)	EUR(779)	ALL(779)	Cystic fibrosis(lung disease)	HPOID:0006552	Fibrocystic lung disease	DOID:1485	cystic fibrosis	NA	NA	NA	NA	Cystic fibrosis	NA	Twin Study	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't
7	112194733	rs3111449	T	C	rs3111449	19242412	2.99E-04	Lung disease severity	NA	NA	241 European ancestry severe cases; 538 European ancestry mild cases	European(779)	ALL(779)	EUR(779)	ALL(779)	Cystic fibrosis(lung disease)	HPOID:0006552	Fibrocystic lung disease	DOID:1485	cystic fibrosis	NA	NA	NA	NA	Cystic fibrosis	NA	Twin Study	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't
11	34834204	rs12793173	T	C	rs12793173	21602797	1.00E-09	p.Phe508del/p.Phe508del only	NA	NA	up to 2,494 individuals with cystic fibrosis	NOPOP(2494)	ALL(2494)	NOPOP(2494)	ALL(2494)	Cystic fibrosis severity	HPOID:0006552	Fibrocystic lung disease	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	cystic fibrosis	Cystic fibrosis	rs12793173-C	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	T	NA
14	70517183	rs12883884	T	G	rs12883884	21602797	8.00E-06	NA	NA	NA	up to 2,494 individuals with cystic fibrosis	NOPOP(2494)	ALL(2494)	NOPOP(2494)	ALL(2494)	Cystic fibrosis severity	HPOID:0006552	Fibrocystic lung disease	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	cystic fibrosis	Cystic fibrosis	rs12883884-T	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	G	SLC8A3
16	62377153	rs11645366	C	T	rs11645366	21602797	7.00E-06	NA	NA	NA	up to 2,494 individuals with cystic fibrosis	NOPOP(2494)	ALL(2494)	NOPOP(2494)	ALL(2494)	Cystic fibrosis severity	HPOID:0006552	Fibrocystic lung disease	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	cystic fibrosis	Cystic fibrosis	rs11645366-C	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	C	NA
19	33850841	rs10518275	A	G	rs10518275	19242412	8.90E-04	Lung disease severity	NA	NA	241 European ancestry severe cases; 538 European ancestry mild cases	European(779)	ALL(779)	EUR(779)	ALL(779)	Cystic fibrosis(lung disease)	HPOID:0006552	Fibrocystic lung disease	DOID:1485	cystic fibrosis	NA	NA	NA	NA	Cystic fibrosis	NA	Twin Study	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't
X	115302192	rs1403543	G	A	rs1403543	21602797	2.00E-06	NA	NA	NA	up to 2,494 individuals with cystic fibrosis	NOPOP(2494)	ALL(2494)	NOPOP(2494)	ALL(2494)	Cystic fibrosis severity	HPOID:0006552	Fibrocystic lung disease	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	cystic fibrosis	Cystic fibrosis	rs1403543-A	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	G	AGTR2
X	115565550	rs12839137	G	A	rs12839137	22466613	1.02E-06	NA	NA	NA	3,763 European ancestry cases	European(3763)	ALL(3763)	EUR(3763)	ALL(3763)	Cystic fibrosis (meconium ileus)	HPOID:0004401	Meconium ileus	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	NA	NA	Cystic fibrosis	NA	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	G
X	115565881	rs5905283	A	C	rs5905283	22466613	1.42E-08	NA	NA	NA	3,763 European ancestry cases	European(3763)	ALL(3763)	EUR(3763)	ALL(3763)	Cystic fibrosis (meconium ileus)	HPOID:0004401	Meconium ileus	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	NA	NA	Cystic fibrosis	NA	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	A
X	115566839	rs3788766	A	G	rs3788766	22466613	1.02E-12	NA	NA	NA	3,763 European ancestry cases	European(3763)	ALL(3763)	EUR(3763)	ALL(3763)	Cystic fibrosis (meconium ileus)	HPOID:0004401	Meconium ileus	DOID:1485	cystic fibrosis	D003550	Cystic Fibrosis	NA	NA	Cystic fibrosis	NA	Research Support, N.I.H., Extramural	Research Support, Non-U.S. Gov't	C

Mapped by lexical matching(Total Items:11)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0006528	Chronic lung disease	MP:0010895	increased lung compliance	increased ability of the lung to distend in response to pressure without disruption, usually expressed as the unit volume of change in the lung per unit of pressure
HP:0003251	Male infertility	MP:0001924	infertility	inability to produce live offspring
HP:0012236	Elevated sweat chloride	MP:0014208	decreased intestinal epithelial chloride transmembrane transport
HP:0001508	Failure to thrive	MP:0013294	prenatal lethality prior to heart atrial septation	death prior to the completion of heart atrial septation (Mus: E14.5-15.5)
HP:0002035	Rectal prolapse	MP:0000493	rectal prolapse	downward movement and external appearance of the rectum through the anus
HP:0004401	Meconium ileus	MP:0014036	meconium ileus	obstruction of the intestine due to abnormally thick meconium in the fetus and neonate
HP:0001738	Exocrine pancreatic insufficiency	MP:0014117	increased pancreatic beta cell apoptosis	increase in the number of pancreatic beta cells undergoing programmed cell death
HP:0006532	Recurrent pneumonia	MP:0001862	interstitial pneumonia	any of a group of inflammatory and fibrotic disorders of the lower respiratory tract, primarily affecting the supporting framework of the lung, including the alveolar wall, but may also involve the small airways and blood vessels of the lung parenchyma
HP:0004313	Decreased antibody level in blood	MP:0011460	decreased urine chloride ion level	abnormally low amounts of chloride ion in the urine
HP:0002206	Pulmonary fibrosis	MP:0009419	skeletal muscle fibrosis	formation of fibrous tissue within skeletal muscle as a result of repair or a reactive process
HP:0002205	Recurrent respiratory infections	MP:0014182	decreased respiratory epithelial sodium ion transmembrane transport	decrease in the directed movement of sodium ions from one side of the respiratory epithelial cell membrane to the other

Mapped by homologous gene(Total Items:21)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0002099	Asthma	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0003251	Male infertility	MP:0014233	bile duct epithelium hyperplasia
HP:0002035	Rectal prolapse	MP:0014233	bile duct epithelium hyperplasia
HP:0002721	Immunodeficiency	MP:0020316	decreased vascular endothelial cell proliferation	decrease in the expansion rate of any vascular endothelial cell population by cell division
HP:0001738	Exocrine pancreatic insufficiency	MP:0014233	bile duct epithelium hyperplasia
HP:0006538	Recurrent bronchopulmonary infections	MP:0014233	bile duct epithelium hyperplasia
HP:0002110	Bronchiectasis	MP:0020154	impaired humoral immune response	impaired response of the immune system that mediates secreted antibodies produced in B cells
HP:0002613	Biliary cirrhosis	MP:0014233	bile duct epithelium hyperplasia
HP:0001508	Failure to thrive	MP:0020234	decreased basal metabolism	decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state
HP:0001648	Cor pulmonale	MP:0014233	bile duct epithelium hyperplasia
HP:0001944	Dehydration	MP:0014206	decreased intestinal epithelial sodium ion transmembrane transport
HP:0002205	Recurrent respiratory infections	MP:0020321	increased vascular endothelial cell apoptosis	increase in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0002150	Hypercalciuria	MP:0020137	decreased bone mineralization	decrease in the rate at which minerals are deposited into bone
HP:0012236	Elevated sweat chloride	MP:0014233	bile duct epithelium hyperplasia
HP:0002206	Pulmonary fibrosis	MP:0014233	bile duct epithelium hyperplasia
HP:0004401	Meconium ileus	MP:0014233	bile duct epithelium hyperplasia
HP:0006528	Chronic lung disease	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals
HP:0002240	Hepatomegaly	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0004313	Decreased antibody level in blood	MP:0020154	impaired humoral immune response	impaired response of the immune system that mediates secreted antibodies produced in B cells
HP:0002024	Malabsorption	MP:0020220	decreased tear production	decreased production of the amount of fluid produced in the eye
HP:0006532	Recurrent pneumonia	MP:0020254	decreased collagen level	decreased level of the main structural protein of the various connective tissues in animals

Disease ID	38
Disease	cystic fibrosis
Case	(Waiting for update.)